ID: 968060247

View in Genome Browser
Species Human (GRCh38)
Location 3:195722323-195722345
Sequence GAGCACAGGCAGGAGGCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 2, 1: 0, 2: 2, 3: 69, 4: 494}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968060247_968060256 27 Left 968060247 3:195722323-195722345 CCCGTGGCCTCCTGCCTGTGCTC 0: 2
1: 0
2: 2
3: 69
4: 494
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968060247 Original CRISPR GAGCACAGGCAGGAGGCCAC GGG (reversed) Intronic