ID: 968060248

View in Genome Browser
Species Human (GRCh38)
Location 3:195722324-195722346
Sequence TGAGCACAGGCAGGAGGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 717
Summary {0: 2, 1: 0, 2: 9, 3: 89, 4: 617}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968060248_968060256 26 Left 968060248 3:195722324-195722346 CCGTGGCCTCCTGCCTGTGCTCA 0: 2
1: 0
2: 9
3: 89
4: 617
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968060248 Original CRISPR TGAGCACAGGCAGGAGGCCA CGG (reversed) Intronic