ID: 968060249

View in Genome Browser
Species Human (GRCh38)
Location 3:195722330-195722352
Sequence CCACGGTGAGCACAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 2, 1: 0, 2: 3, 3: 25, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968060249_968060256 20 Left 968060249 3:195722330-195722352 CCTCCTGCCTGTGCTCACCGTGG 0: 2
1: 0
2: 3
3: 25
4: 261
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060249_968060259 25 Left 968060249 3:195722330-195722352 CCTCCTGCCTGTGCTCACCGTGG 0: 2
1: 0
2: 3
3: 25
4: 261
Right 968060259 3:195722378-195722400 TTAGCTCCACCTTACAGGTGCGG 0: 2
1: 2
2: 16
3: 183
4: 1152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968060249 Original CRISPR CCACGGTGAGCACAGGCAGG AGG (reversed) Intronic