ID: 968060251

View in Genome Browser
Species Human (GRCh38)
Location 3:195722333-195722355
Sequence AGGCCACGGTGAGCACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 2, 1: 2, 2: 0, 3: 36, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968060251_968060256 17 Left 968060251 3:195722333-195722355 CCTGCCTGTGCTCACCGTGGCCT 0: 2
1: 2
2: 0
3: 36
4: 255
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060251_968060259 22 Left 968060251 3:195722333-195722355 CCTGCCTGTGCTCACCGTGGCCT 0: 2
1: 2
2: 0
3: 36
4: 255
Right 968060259 3:195722378-195722400 TTAGCTCCACCTTACAGGTGCGG 0: 2
1: 2
2: 16
3: 183
4: 1152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968060251 Original CRISPR AGGCCACGGTGAGCACAGGC AGG (reversed) Intronic