ID: 968060253

View in Genome Browser
Species Human (GRCh38)
Location 3:195722337-195722359
Sequence GACCAGGCCACGGTGAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 2, 1: 0, 2: 4, 3: 13, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968060253_968060256 13 Left 968060253 3:195722337-195722359 CCTGTGCTCACCGTGGCCTGGTC 0: 2
1: 0
2: 4
3: 13
4: 179
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060253_968060262 27 Left 968060253 3:195722337-195722359 CCTGTGCTCACCGTGGCCTGGTC 0: 2
1: 0
2: 4
3: 13
4: 179
Right 968060262 3:195722387-195722409 CCTTACAGGTGCGGAAATGCAGG 0: 2
1: 1
2: 0
3: 12
4: 181
968060253_968060259 18 Left 968060253 3:195722337-195722359 CCTGTGCTCACCGTGGCCTGGTC 0: 2
1: 0
2: 4
3: 13
4: 179
Right 968060259 3:195722378-195722400 TTAGCTCCACCTTACAGGTGCGG 0: 2
1: 2
2: 16
3: 183
4: 1152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968060253 Original CRISPR GACCAGGCCACGGTGAGCAC AGG (reversed) Intronic