ID: 968060254

View in Genome Browser
Species Human (GRCh38)
Location 3:195722347-195722369
Sequence GTGCAGCGCAGACCAGGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 2, 1: 0, 2: 1, 3: 19, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968060254_968060256 3 Left 968060254 3:195722347-195722369 CCGTGGCCTGGTCTGCGCTGCAC 0: 2
1: 0
2: 1
3: 19
4: 207
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060254_968060259 8 Left 968060254 3:195722347-195722369 CCGTGGCCTGGTCTGCGCTGCAC 0: 2
1: 0
2: 1
3: 19
4: 207
Right 968060259 3:195722378-195722400 TTAGCTCCACCTTACAGGTGCGG 0: 2
1: 2
2: 16
3: 183
4: 1152
968060254_968060263 22 Left 968060254 3:195722347-195722369 CCGTGGCCTGGTCTGCGCTGCAC 0: 2
1: 0
2: 1
3: 19
4: 207
Right 968060263 3:195722392-195722414 CAGGTGCGGAAATGCAGGCTTGG 0: 2
1: 0
2: 2
3: 41
4: 343
968060254_968060262 17 Left 968060254 3:195722347-195722369 CCGTGGCCTGGTCTGCGCTGCAC 0: 2
1: 0
2: 1
3: 19
4: 207
Right 968060262 3:195722387-195722409 CCTTACAGGTGCGGAAATGCAGG 0: 2
1: 1
2: 0
3: 12
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968060254 Original CRISPR GTGCAGCGCAGACCAGGCCA CGG (reversed) Intronic