ID: 968060255

View in Genome Browser
Species Human (GRCh38)
Location 3:195722353-195722375
Sequence GGACACGTGCAGCGCAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968060255_968060262 11 Left 968060255 3:195722353-195722375 CCTGGTCTGCGCTGCACGTGTCC 0: 2
1: 0
2: 0
3: 6
4: 81
Right 968060262 3:195722387-195722409 CCTTACAGGTGCGGAAATGCAGG 0: 2
1: 1
2: 0
3: 12
4: 181
968060255_968060256 -3 Left 968060255 3:195722353-195722375 CCTGGTCTGCGCTGCACGTGTCC 0: 2
1: 0
2: 0
3: 6
4: 81
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060255_968060263 16 Left 968060255 3:195722353-195722375 CCTGGTCTGCGCTGCACGTGTCC 0: 2
1: 0
2: 0
3: 6
4: 81
Right 968060263 3:195722392-195722414 CAGGTGCGGAAATGCAGGCTTGG 0: 2
1: 0
2: 2
3: 41
4: 343
968060255_968060259 2 Left 968060255 3:195722353-195722375 CCTGGTCTGCGCTGCACGTGTCC 0: 2
1: 0
2: 0
3: 6
4: 81
Right 968060259 3:195722378-195722400 TTAGCTCCACCTTACAGGTGCGG 0: 2
1: 2
2: 16
3: 183
4: 1152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968060255 Original CRISPR GGACACGTGCAGCGCAGACC AGG (reversed) Intronic