ID: 968060256

View in Genome Browser
Species Human (GRCh38)
Location 3:195722373-195722395
Sequence TCCCGTTAGCTCCACCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 47}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968060253_968060256 13 Left 968060253 3:195722337-195722359 CCTGTGCTCACCGTGGCCTGGTC 0: 2
1: 0
2: 4
3: 13
4: 179
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060249_968060256 20 Left 968060249 3:195722330-195722352 CCTCCTGCCTGTGCTCACCGTGG 0: 2
1: 0
2: 3
3: 25
4: 261
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060246_968060256 28 Left 968060246 3:195722322-195722344 CCCCGTGGCCTCCTGCCTGTGCT 0: 2
1: 0
2: 4
3: 49
4: 426
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060247_968060256 27 Left 968060247 3:195722323-195722345 CCCGTGGCCTCCTGCCTGTGCTC 0: 2
1: 0
2: 2
3: 69
4: 494
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060254_968060256 3 Left 968060254 3:195722347-195722369 CCGTGGCCTGGTCTGCGCTGCAC 0: 2
1: 0
2: 1
3: 19
4: 207
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060255_968060256 -3 Left 968060255 3:195722353-195722375 CCTGGTCTGCGCTGCACGTGTCC 0: 2
1: 0
2: 0
3: 6
4: 81
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060248_968060256 26 Left 968060248 3:195722324-195722346 CCGTGGCCTCCTGCCTGTGCTCA 0: 2
1: 0
2: 9
3: 89
4: 617
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060251_968060256 17 Left 968060251 3:195722333-195722355 CCTGCCTGTGCTCACCGTGGCCT 0: 2
1: 2
2: 0
3: 36
4: 255
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968060256 Original CRISPR TCCCGTTAGCTCCACCTTAC AGG Intronic
900821223 1:4890357-4890379 TCTCGTTAGCTCCCCTTTGCAGG - Intergenic
909136486 1:71806966-71806988 TACCGCAAGCTCCACCTTCCGGG + Intronic
909984779 1:82147263-82147285 TCCCATTATCTCCATTTTACAGG - Intergenic
910191355 1:84599177-84599199 TCCCACCAGTTCCACCTTACAGG + Intergenic
911739496 1:101371503-101371525 ACCCATTAGCTTCACCTTTCAGG - Intergenic
916034092 1:160905790-160905812 GCCCATTAGCTCCACCTGAAGGG + Intergenic
916488038 1:165276863-165276885 TGCTGATAACTCCACCTTACAGG + Intronic
1062985230 10:1762121-1762143 TCCCGTTGTCTCTATCTTACAGG + Intergenic
1065244651 10:23744806-23744828 TCCCTTTATCTCCAACTCACAGG - Intronic
1070916880 10:80160789-80160811 TCCCTGCAGCTCCACCCTACAGG + Intronic
1082763817 11:57150770-57150792 TCCCCTTAGCTCCTGCTTGCTGG + Intergenic
1087869975 11:103280948-103280970 TCTCGTTAGCTCCAGCTCAAGGG - Intronic
1091705077 12:2688328-2688350 TCCAGCTAGCTCCACCTGCCTGG - Intronic
1096783549 12:54004550-54004572 TCCCCGTAGCATCACCTTACAGG + Intronic
1106007681 13:25786619-25786641 CCCTGTTAGTTCCACCTTAGAGG + Intronic
1117872591 14:60216933-60216955 TCCAGTTAGCACCAGCTTCCAGG - Intergenic
1124078025 15:26464069-26464091 TACCACTAGCTCTACCTTACAGG + Intergenic
1133011594 16:2915448-2915470 ACTCCTGAGCTCCACCTTACTGG + Intronic
1135669112 16:24360122-24360144 TCCATTTAGCACCACCCTACAGG + Intronic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1143720169 17:8803686-8803708 TCCAGTTAGCTGACCCTTACTGG - Intronic
1148957667 17:51366870-51366892 TACCATTAGCTCCATTTTACAGG - Intergenic
1154402257 18:14051343-14051365 TCCCCTTAGCTCCAAGTTGCAGG - Intergenic
1155447296 18:25925541-25925563 TCCAGTTAACTCCAACTTTCAGG + Intergenic
1165317800 19:35067152-35067174 TCTCCCTATCTCCACCTTACAGG - Intergenic
927521909 2:23704021-23704043 TGCCGTGGGCTCCACCCTACTGG - Intronic
930999021 2:57759281-57759303 TCCAGTTATCTCCACCTTTTAGG - Intergenic
938592723 2:132755121-132755143 TCCCATTAGCTCCTTCTTACTGG + Intronic
943300960 2:186199245-186199267 TCCCCTTATCTCCCCATTACTGG + Intergenic
947988360 2:234467629-234467651 TCCTGTTACCTCCAGCTCACAGG - Intergenic
948364522 2:237446105-237446127 TCCCGCTAGCCCCACCTTGCCGG + Intergenic
1170577640 20:17676372-17676394 GCCAGCTAGCTCCACCTTTCAGG - Intronic
1183191641 22:36325404-36325426 TCCCGGTGGCTCCACCTTACTGG - Intronic
1183494757 22:38136514-38136536 TACCGTTACCTCCACCTCCCGGG - Intronic
1183602710 22:38849392-38849414 TACCACTGGCTCCACCTTACAGG - Intergenic
951645007 3:24880033-24880055 TCCCCTTAGCTCTACGTTCCTGG + Intergenic
961787935 3:129358740-129358762 TACGATTAGCTCCACTTTACAGG + Intergenic
968044467 3:195616322-195616344 TCCCGTTAGCTCCACCTTACAGG + Intergenic
968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG + Intronic
975452225 4:74542033-74542055 TCGCGTTTGCTCCTCCTTCCAGG - Intergenic
978783579 4:112583094-112583116 TTCCGATATCTCCATCTTACGGG + Intronic
979115944 4:116822938-116822960 TTCCATTAGCTCTACCTTCCAGG - Intergenic
980619373 4:135278649-135278671 TCACATTAGCTCCTCCTTCCAGG + Intergenic
980987924 4:139714018-139714040 TCCCGTGGTCTCCACCTTCCAGG - Intronic
985769858 5:1802073-1802095 CCTCCTTAGCTCCACCTTCCCGG + Intronic
1000295283 5:159908287-159908309 TACCGTTAGCTCCAATTTACAGG - Intergenic
1003537268 6:6986175-6986197 TACTGTTAGCTTCACTTTACAGG - Intergenic
1026216776 7:68356553-68356575 TACCGCAACCTCCACCTTACGGG - Intergenic
1027054149 7:75038662-75038684 TCCAGTTAGCCCCAGCTCACAGG - Intronic
1031263103 7:119548227-119548249 TCCCCTTTGCTCCACATTATTGG - Intergenic
1060899620 9:127245763-127245785 TGCTGTTATCTCCACTTTACAGG + Intronic
1062151543 9:135021749-135021771 TCCCGTAAGCCCCATCTGACCGG + Intergenic
1187487392 X:19717332-19717354 TCCCTTTCCCTCCACCTTTCAGG - Intronic
1196644820 X:118106249-118106271 TACTCTTAGCTCCACCTCACAGG + Intronic