ID: 968060256

View in Genome Browser
Species Human (GRCh38)
Location 3:195722373-195722395
Sequence TCCCGTTAGCTCCACCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 47}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968060255_968060256 -3 Left 968060255 3:195722353-195722375 CCTGGTCTGCGCTGCACGTGTCC 0: 2
1: 0
2: 0
3: 6
4: 81
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060247_968060256 27 Left 968060247 3:195722323-195722345 CCCGTGGCCTCCTGCCTGTGCTC 0: 2
1: 0
2: 2
3: 69
4: 494
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060248_968060256 26 Left 968060248 3:195722324-195722346 CCGTGGCCTCCTGCCTGTGCTCA 0: 2
1: 0
2: 9
3: 89
4: 617
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060251_968060256 17 Left 968060251 3:195722333-195722355 CCTGCCTGTGCTCACCGTGGCCT 0: 2
1: 2
2: 0
3: 36
4: 255
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060254_968060256 3 Left 968060254 3:195722347-195722369 CCGTGGCCTGGTCTGCGCTGCAC 0: 2
1: 0
2: 1
3: 19
4: 207
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060249_968060256 20 Left 968060249 3:195722330-195722352 CCTCCTGCCTGTGCTCACCGTGG 0: 2
1: 0
2: 3
3: 25
4: 261
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060246_968060256 28 Left 968060246 3:195722322-195722344 CCCCGTGGCCTCCTGCCTGTGCT 0: 2
1: 0
2: 4
3: 49
4: 426
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47
968060253_968060256 13 Left 968060253 3:195722337-195722359 CCTGTGCTCACCGTGGCCTGGTC 0: 2
1: 0
2: 4
3: 13
4: 179
Right 968060256 3:195722373-195722395 TCCCGTTAGCTCCACCTTACAGG 0: 2
1: 0
2: 1
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968060256 Original CRISPR TCCCGTTAGCTCCACCTTAC AGG Intronic