ID: 968061518

View in Genome Browser
Species Human (GRCh38)
Location 3:195729691-195729713
Sequence TGGGGTCAGTGAGGTCTTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 5, 3: 65, 4: 427}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968061518_968061531 28 Left 968061518 3:195729691-195729713 CCCGGAAGACCTCACTGACCCCA 0: 1
1: 0
2: 5
3: 65
4: 427
Right 968061531 3:195729742-195729764 GAGTGGGCACTTTCCGGGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 110
968061518_968061527 11 Left 968061518 3:195729691-195729713 CCCGGAAGACCTCACTGACCCCA 0: 1
1: 0
2: 5
3: 65
4: 427
Right 968061527 3:195729725-195729747 AGGCTGATGCAGCAGGTGAGTGG 0: 1
1: 0
2: 2
3: 63
4: 509
968061518_968061532 29 Left 968061518 3:195729691-195729713 CCCGGAAGACCTCACTGACCCCA 0: 1
1: 0
2: 5
3: 65
4: 427
Right 968061532 3:195729743-195729765 AGTGGGCACTTTCCGGGCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 122
968061518_968061526 4 Left 968061518 3:195729691-195729713 CCCGGAAGACCTCACTGACCCCA 0: 1
1: 0
2: 5
3: 65
4: 427
Right 968061526 3:195729718-195729740 GGCAGAAAGGCTGATGCAGCAGG 0: 1
1: 0
2: 0
3: 35
4: 370
968061518_968061530 23 Left 968061518 3:195729691-195729713 CCCGGAAGACCTCACTGACCCCA 0: 1
1: 0
2: 5
3: 65
4: 427
Right 968061530 3:195729737-195729759 CAGGTGAGTGGGCACTTTCCGGG 0: 1
1: 1
2: 0
3: 26
4: 213
968061518_968061529 22 Left 968061518 3:195729691-195729713 CCCGGAAGACCTCACTGACCCCA 0: 1
1: 0
2: 5
3: 65
4: 427
Right 968061529 3:195729736-195729758 GCAGGTGAGTGGGCACTTTCCGG 0: 1
1: 0
2: 1
3: 14
4: 178
968061518_968061522 -9 Left 968061518 3:195729691-195729713 CCCGGAAGACCTCACTGACCCCA 0: 1
1: 0
2: 5
3: 65
4: 427
Right 968061522 3:195729705-195729727 CTGACCCCAGAGTGGCAGAAAGG 0: 1
1: 0
2: 1
3: 26
4: 259
968061518_968061528 12 Left 968061518 3:195729691-195729713 CCCGGAAGACCTCACTGACCCCA 0: 1
1: 0
2: 5
3: 65
4: 427
Right 968061528 3:195729726-195729748 GGCTGATGCAGCAGGTGAGTGGG 0: 1
1: 0
2: 3
3: 24
4: 271
968061518_968061533 30 Left 968061518 3:195729691-195729713 CCCGGAAGACCTCACTGACCCCA 0: 1
1: 0
2: 5
3: 65
4: 427
Right 968061533 3:195729744-195729766 GTGGGCACTTTCCGGGCCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968061518 Original CRISPR TGGGGTCAGTGAGGTCTTCC GGG (reversed) Exonic
900217468 1:1489477-1489499 TGGGGTCAGTCCTGTCTTCACGG + Intronic
900515999 1:3082521-3082543 TGGGGTGAGGGAGGTTTCCCCGG - Intronic
901759312 1:11460410-11460432 AGGGGTCAGTGACGGCTCCCAGG - Intergenic
901810926 1:11766437-11766459 TGGGGACAGCCAGGTCCTCCAGG - Exonic
901857249 1:12052467-12052489 AGTGGTCAGTGAGGGCTTCCTGG - Intergenic
902167120 1:14581618-14581640 TGGGGACTGTGAGGTCTTGTAGG - Intergenic
902178719 1:14671111-14671133 GGTGGTCAGTGAAGGCTTCCTGG + Intronic
902633296 1:17718717-17718739 GGAGGTCAGGGAGGTCTTCCTGG + Intergenic
903370589 1:22832647-22832669 TGTGGTCAGGGAGGGATTCCTGG - Intronic
903384828 1:22919485-22919507 TGGGGTCTGTGGGGTCTCCCAGG - Intergenic
903420484 1:23215471-23215493 AGGGGTCAGCCATGTCTTCCAGG - Intergenic
903646968 1:24901813-24901835 TGGAGACAGTGAGGTCCTTCCGG + Exonic
904043187 1:27595792-27595814 TGGTGTCAGGGAGGTGTTGCAGG + Intronic
904255493 1:29251911-29251933 GGTGGTCAGGGAGGACTTCCTGG - Intronic
904424543 1:30414981-30415003 TGAGGTCAGAGAGGTCGGCCAGG - Intergenic
904453378 1:30631315-30631337 TGGGGATAGTCAGGTCTACCTGG + Intergenic
904499256 1:30904786-30904808 TGGGGTCAGGGAAGGCTTCCTGG - Intronic
904630517 1:31838491-31838513 GGGAGTCAGGGAGGTCTCCCTGG + Intergenic
906293758 1:44636556-44636578 TGGGGGCCCTGAGGGCTTCCAGG + Intronic
906301261 1:44683417-44683439 TGGGGTGAATGAGGTCACCCAGG + Intronic
906461321 1:46036870-46036892 TGTAGCCAGTGAGCTCTTCCTGG + Intergenic
906704524 1:47885288-47885310 GGGAGTCAGCGAGGGCTTCCTGG - Intronic
906938157 1:50232622-50232644 TGGGGTCAGGAAAGTCTTCCTGG - Intergenic
908427178 1:64018443-64018465 TGGAGTCAGGGAAGTCTTCTTGG - Intronic
909039737 1:70634917-70634939 TGAGATCAGTGAGTTCTTCATGG - Intergenic
912872907 1:113326479-113326501 GTGGGTCAGAGAAGTCTTCCTGG - Intergenic
913544912 1:119858770-119858792 TGGGGGGACTGAGGTCTTCCTGG + Intergenic
913992284 1:143625943-143625965 TGGAGGGACTGAGGTCTTCCTGG + Intergenic
914855075 1:151344762-151344784 AGGTGTCAGTGTGCTCTTCCAGG + Exonic
915211702 1:154314310-154314332 AGGGGTCAGTGTGGTCATCTTGG - Intergenic
915912483 1:159923474-159923496 TGGGGGCAGGGAGGACTTCAGGG + Exonic
916989135 1:170223387-170223409 TGAGTTCAGAGAGGGCTTCCAGG - Intergenic
917131222 1:171743802-171743824 TGTGGTCAGTGAGCTCTAACAGG + Intergenic
919751356 1:201040098-201040120 TAGGCTGAGTGGGGTCTTCCTGG + Intronic
919929614 1:202212946-202212968 GTGGGTCAGGGAGGGCTTCCTGG - Intronic
920039026 1:203084109-203084131 TGGGGTGACAGAGGTTTTCCAGG + Intronic
921188383 1:212689041-212689063 TGTGGTCAGGGAAGCCTTCCTGG - Intronic
921217609 1:212950867-212950889 CGGGGTCCGGGAGGGCTTCCTGG + Intronic
922167125 1:223125546-223125568 TGTGGTCAGTCTGGGCTTCCTGG - Intronic
922167725 1:223129581-223129603 TGGGGTCAGGGAGGTGTGACTGG + Intronic
923050901 1:230390663-230390685 TGGGGCCAGGGAAGGCTTCCTGG + Intronic
924647104 1:245888076-245888098 TGGGGTGAGTCAGGGCTCCCTGG + Intronic
1064119843 10:12609145-12609167 GTGGGTCAGGGAGGGCTTCCTGG + Intronic
1065499043 10:26360866-26360888 GAGGGTCAGTGAGGTTTTCACGG - Intergenic
1066291996 10:34022739-34022761 AGGGGACAGAGAGGTCTTCCTGG + Intergenic
1066370208 10:34814231-34814253 TGGGGTCGGGGAGGCGTTCCCGG - Intronic
1067314757 10:45151125-45151147 TGGGGTGAGCGAGGTCTGCTAGG + Intergenic
1068508561 10:57934576-57934598 TGGGGTCAGTGGGGTCTGTGGGG + Intergenic
1069596755 10:69676971-69676993 TGGTGTCCCTGAAGTCTTCCTGG - Intergenic
1069856601 10:71444474-71444496 GGTGGTCAGGGAGGGCTTCCTGG + Intronic
1069932387 10:71891505-71891527 GGGGGTCAGAGAGAGCTTCCTGG + Intergenic
1069955714 10:72050129-72050151 TGGGATCAGGGAGGGCTTCATGG + Intergenic
1070778931 10:79126429-79126451 AGGGGTCAGGGAGAGCTTCCTGG + Intronic
1071450534 10:85788504-85788526 TGGGGCCAGTGAAGTTTTCTTGG + Intronic
1072692454 10:97580926-97580948 TGGGGCCACTGTGGACTTCCAGG + Exonic
1072740359 10:97905433-97905455 CGTGGTCAGGGAGGGCTTCCCGG - Intronic
1073073777 10:100810692-100810714 TGGGGTTAGAGAAGTCTCCCGGG - Intronic
1073404638 10:103286536-103286558 TGGAGGCAGAGAGGTCTTCCTGG + Intronic
1073802277 10:107055105-107055127 TGGGACCAGGGAGGTCTTCATGG + Intronic
1074158127 10:110815864-110815886 TGGGGTCAGTAGGGACTTACTGG + Intronic
1075309962 10:121405730-121405752 TAGGCTCAGTGAGTGCTTCCTGG + Intergenic
1075319620 10:121480233-121480255 TGGTCTCAGGGAGGTCTTCGTGG - Intronic
1075666623 10:124235448-124235470 TGGGGTTAGGGTGGCCTTCCTGG - Intergenic
1075672192 10:124270353-124270375 AGGGGTGAGTGAGGTCAGCCTGG - Intergenic
1075943180 10:126408865-126408887 TGGGGTCAGGAACGCCTTCCTGG + Intergenic
1076061768 10:127418763-127418785 GTGGGTCAGTGGGGGCTTCCTGG - Intronic
1076984160 11:223481-223503 TGGGGTCAGGGAGGCCTTTGGGG - Intronic
1077145016 11:1040843-1040865 TGGGGTCAGAGGGGTCTGCAGGG - Intergenic
1077387181 11:2275576-2275598 TGGGATCAGGGAAGGCTTCCAGG - Intergenic
1077644216 11:3909217-3909239 TGGGGTCAGTGATGTCTCCAGGG + Intronic
1078762789 11:14264807-14264829 TGGGGTCAGGGAAGTTTTCTTGG + Intronic
1079354572 11:19719504-19719526 AGGGTTCAGTGAGATATTCCAGG + Intronic
1080661131 11:34296861-34296883 TAGGGACAGTGATGTCCTCCAGG + Intronic
1081968817 11:47185167-47185189 TCGGCTCCGAGAGGTCTTCCTGG + Intronic
1082001378 11:47395280-47395302 TGGCCTCAGTGAGGACTGCCAGG - Intergenic
1082750157 11:57006271-57006293 TGGGGTCAGTGGGGCCTTCCTGG + Intergenic
1082784806 11:57311114-57311136 TGAGGGCTGAGAGGTCTTCCTGG - Intronic
1082800861 11:57413938-57413960 TGGTGTCAGGGAAGGCTTCCTGG - Intronic
1083625102 11:64068327-64068349 TGGGGACAGTGATGCCTACCAGG + Intronic
1083633180 11:64106112-64106134 TGGGGTCAGAGAGGTCCCGCTGG + Intronic
1084168758 11:67390185-67390207 AGGGGTCAGTGAGTTTCTCCAGG + Intronic
1084220545 11:67674939-67674961 TGGGGCCTGGGAGGACTTCCTGG - Intronic
1084335832 11:68457433-68457455 TGAAGTCAGGGAGGACTTCCTGG - Intergenic
1084593857 11:70105643-70105665 TGGGGACAGTGTGGTTTCCCAGG + Intronic
1085346871 11:75773843-75773865 TGAGGTCAGGGAAGTCTTCCTGG + Intronic
1085405575 11:76259844-76259866 TGAGGACAGGGAGGGCTTCCAGG + Intergenic
1085533194 11:77203562-77203584 AGGGGGCAGAGAGGACTTCCTGG + Intronic
1087849561 11:103012386-103012408 TGAGGCCAGGGAGGTCTTCAGGG - Intergenic
1088923908 11:114281461-114281483 GGAGGTCAATGAAGTCTTCCTGG + Intronic
1089195553 11:116692319-116692341 AGGGCTCAGTGAAGGCTTCCTGG - Intergenic
1089673440 11:120073081-120073103 GGGGGTCAGGGAGGTCTCCCAGG + Intergenic
1089743869 11:120603602-120603624 TGGGGTCAGGGACATCTTCCAGG - Intronic
1089770080 11:120796542-120796564 GGGGGTCAGAGAGGGCTTCCTGG + Intronic
1089937165 11:122376031-122376053 TCCGGCCAGTGAGGTCTCCCAGG - Intergenic
1090050721 11:123376469-123376491 TGGGGTCAGTGAAGGTTTTCAGG + Intergenic
1090405859 11:126475525-126475547 TGGGGTCAGTGATGGCTTCTCGG - Intronic
1091065328 11:132504864-132504886 CGGGGTCACTGAGGTCCCCCTGG + Intronic
1091482603 12:849459-849481 TTGGGTCTATGAGATCTTCCTGG + Intronic
1091823330 12:3492050-3492072 TGGGCTCCGTGAGGGCTCCCGGG + Intronic
1093540201 12:20273657-20273679 AGGGGTCATTGAGGTATTCCAGG - Intergenic
1093545504 12:20341769-20341791 TGGAGTCACTGATGTCTCCCAGG - Intergenic
1094640531 12:32270925-32270947 TGTGTTCAGTGGGGTCTTCAAGG + Intronic
1095950656 12:47780137-47780159 TGGGGTCTGTGAGGCCTGCAGGG - Exonic
1096421570 12:51462943-51462965 TGGGGTCAGTCAGGATTACCTGG + Intronic
1097195656 12:57241274-57241296 TTGGGTCAGTGGGGTCCGCCCGG - Intergenic
1099341001 12:81434011-81434033 TGGGGTTATGGAGGTATTCCAGG + Intronic
1100947814 12:99806610-99806632 TCGGGTCAGTGAGCTCTTCTAGG + Exonic
1101422465 12:104560909-104560931 TGTGGTCAGCCATGTCTTCCGGG + Intronic
1101439617 12:104693689-104693711 GGGGGTCAGGGAGGGCTTCCTGG + Intronic
1101794587 12:107961131-107961153 GGGGTTTAGTGAGGTCTTCTGGG - Intergenic
1102572484 12:113835539-113835561 CGGGGTCAGTGGGGGCTGCCGGG + Intronic
1102577087 12:113862697-113862719 TGGGCTCAGGGAGGAGTTCCTGG - Intronic
1102778151 12:115539111-115539133 TGAGGTCAGGGAAGGCTTCCTGG + Intergenic
1102983799 12:117262963-117262985 GGAGGTCAGGGAGGGCTTCCTGG - Intronic
1103345039 12:120243735-120243757 TAAGGTCAGGGAGGGCTTCCTGG - Intronic
1103894129 12:124262001-124262023 AGGCGTGAGTGAGGTCTCCCTGG - Intronic
1103899722 12:124296951-124296973 AAGGGGCAGTGAGGACTTCCAGG + Intronic
1103943387 12:124512944-124512966 TGGGGCCAGGGAGGGCTTCCTGG + Intronic
1103994477 12:124820373-124820395 AGGAGTCCGGGAGGTCTTCCTGG + Intronic
1104258986 12:127165752-127165774 TGTGGTCAGGGAAGGCTTCCTGG + Intergenic
1104848961 12:131862042-131862064 GGTGGTCAGTGAGGGCTTCCTGG + Intergenic
1105041771 12:132966766-132966788 CGAGGTCAGGGGGGTCTTCCTGG - Intergenic
1106962452 13:35014794-35014816 TGGGCTCAGTGAGGTTGCCCAGG + Intronic
1107555422 13:41513381-41513403 TAGGGTCAGGAAGGGCTTCCTGG + Intergenic
1110641156 13:77825982-77826004 TGGGAACAGTGAGATCTTGCAGG - Intergenic
1111676851 13:91398869-91398891 TGGGAGCAGTTAGCTCTTCCCGG - Exonic
1112667945 13:101598296-101598318 AGGGGTAAGTGAGGTCTCTCAGG + Exonic
1112716133 13:102188191-102188213 TGGGGTCAGTGAGATATTAGAGG + Intronic
1113386010 13:109848920-109848942 TGGGGTCAGGGAGGTGGGCCTGG + Intergenic
1114083244 14:19219485-19219507 TGGGGTGAGCCAGGTCCTCCTGG + Intergenic
1114767450 14:25390151-25390173 AGGGGTCAGGAAAGTCTTCCTGG + Intergenic
1115013893 14:28586438-28586460 TGGTGTCAGTGAATACTTCCTGG - Intergenic
1115202516 14:30869990-30870012 TGGGGGCTGTGCTGTCTTCCAGG - Intergenic
1115345887 14:32343111-32343133 TGGGGCCAGTTAGATCTTCTGGG + Intronic
1117162372 14:53002082-53002104 TGGGTTCAGGGATGGCTTCCCGG - Intergenic
1117847301 14:59924775-59924797 TGAGGTCAGAGAGGTATTTCAGG - Intronic
1119265565 14:73261690-73261712 AGGGGTCAGGGAGGTCTTTGAGG + Intronic
1119401497 14:74365591-74365613 TGGGGTCAGGGAGGTATTTGGGG + Intergenic
1119416359 14:74472681-74472703 GGTGGTCAGGGAGGGCTTCCTGG + Intergenic
1119735283 14:76977669-76977691 TGGGGTCAGGGACCTCTTCCAGG - Intergenic
1120917069 14:89719685-89719707 TGGGACCAGTGAGGGCTTCAGGG - Intergenic
1121427151 14:93860441-93860463 GGGGCTCAGTGAGCTCTTGCTGG + Intergenic
1121462941 14:94096007-94096029 TGTGGCCAGGGAAGTCTTCCTGG + Intronic
1121634829 14:95446803-95446825 TGGGGTCAGGGAAGGCTTCCTGG - Intronic
1121649538 14:95547632-95547654 TGGGGTCAGGGAAGGCTTTCTGG - Intergenic
1122227954 14:100290682-100290704 GGAGGTCAGAGAGGGCTTCCTGG - Intergenic
1122420170 14:101571459-101571481 GGAGGTCAGGGAGGGCTTCCTGG + Intergenic
1122782918 14:104151166-104151188 TGGAGGCAGTGACATCTTCCAGG - Intronic
1122974691 14:105166266-105166288 TGGGGGCAGGGAGGTCTTGGAGG - Intronic
1123047898 14:105527381-105527403 TGGGCCCAGAGAGGGCTTCCTGG + Intronic
1202894866 14_GL000194v1_random:1255-1277 TGGGGTGAGCCAGGTCCTCCTGG + Intergenic
1124416045 15:29473969-29473991 TAGGTTCAGTGCTGTCTTCCAGG - Intronic
1124590853 15:31051677-31051699 GGGGGTCAATGAGGTCGTCAAGG - Intronic
1125334155 15:38611300-38611322 TGGGTTCAGTGATGGCCTCCAGG + Intergenic
1125738913 15:41947881-41947903 TGGGGTCAGGCAGACCTTCCTGG - Intronic
1125967537 15:43886479-43886501 TGGGCTCAGTGAAGTCACCCAGG - Intronic
1126773238 15:52078167-52078189 AGAGGTCAGGGAGGGCTTCCTGG - Intergenic
1127395206 15:58539025-58539047 TTTGGTCAGTGAAGTCCTCCAGG + Intronic
1127796770 15:62445096-62445118 AGGGGTCAGGGAGGCCTTACTGG + Intronic
1128359627 15:66952958-66952980 TGTGGTCAGGGAAGCCTTCCTGG - Intergenic
1129177174 15:73848401-73848423 GGGAGTCAGGGAGGCCTTCCTGG - Intergenic
1129697453 15:77748640-77748662 TGGGGTCCATGACCTCTTCCTGG - Intronic
1129741940 15:77993539-77993561 TGGGGGCAGGAAGGTCTTCCGGG + Intronic
1129843767 15:78758932-78758954 TGGGGGCAGGAAGGTCTTCCGGG - Intergenic
1130136979 15:81189612-81189634 GGGTGTCAGGGAAGTCTTCCTGG + Intronic
1130258040 15:82334868-82334890 TGGGGGCAGGAAGGTCTTCTGGG + Intergenic
1130533952 15:84769632-84769654 TGGGGGCAGTGAGATCATCCCGG + Intronic
1130596892 15:85255095-85255117 TGGGGGCAGGAAGGTCTTCTGGG - Intergenic
1131116693 15:89800288-89800310 AGAGGTCAGGGAGGGCTTCCCGG - Intronic
1133019890 16:2962784-2962806 GGGGCTCAGTGAAGTCCTCCCGG - Intergenic
1133136332 16:3714711-3714733 AGGGGTCAGTGAGGTCTGAAAGG + Intronic
1133596144 16:7294666-7294688 TGGGGTCAGCGATATATTCCTGG + Intronic
1133813801 16:9181216-9181238 AGAGGTCAGAGAGGGCTTCCTGG + Intergenic
1134012598 16:10866450-10866472 TAGGGTCAAAGAGATCTTCCTGG - Intergenic
1135628339 16:24015504-24015526 TGGTGTCAGCCAGGTCTACCTGG + Intronic
1136003231 16:27312031-27312053 TGGGGTCAGGGATGGCTTCCTGG - Intergenic
1136517638 16:30777580-30777602 TGGGGACACTGAGGTCTATCAGG - Intergenic
1137724988 16:50651003-50651025 GGGGGTCAGGGAGGGCTTCCTGG - Intergenic
1139346578 16:66307647-66307669 GGGAGTCAGGGAGGACTTCCTGG + Intergenic
1139361082 16:66400684-66400706 TGCAGTCAGGGAGGGCTTCCTGG + Intronic
1141102354 16:81207297-81207319 GTGAGTGAGTGAGGTCTTCCCGG + Intergenic
1141993235 16:87622022-87622044 TGGGGTCACTGGGGTGTTCTGGG + Intronic
1142105235 16:88299076-88299098 GGGGGGCAGGGAGGGCTTCCTGG + Intergenic
1142127670 16:88418256-88418278 TGTGGTCAGGGAGGGCTTCCTGG + Intergenic
1142259687 16:89036883-89036905 GGTGGTCAGGGAAGTCTTCCTGG - Intergenic
1142382562 16:89741599-89741621 TGGGGGCAGTCAGGCTTTCCAGG + Intronic
1143105172 17:4526172-4526194 TGGGGTCAGGGAGGGCTTCCTGG + Intronic
1143619175 17:8071460-8071482 CTGGGTCAGGGAGATCTTCCAGG + Intergenic
1144585220 17:16483512-16483534 TGTGGTCAGTTATTTCTTCCAGG - Intronic
1145974591 17:28976874-28976896 GGGGGTCAGGGAAGGCTTCCTGG - Intronic
1147449822 17:40497195-40497217 GGAGGTTAGGGAGGTCTTCCTGG + Intronic
1148677725 17:49454927-49454949 AGAGGTCAGGGAGGACTTCCTGG - Intronic
1150008140 17:61482417-61482439 TTGGCTCCCTGAGGTCTTCCTGG + Intronic
1150161649 17:62903015-62903037 TGTGGTCAGGGAGGACTTCCTGG - Intergenic
1151386256 17:73757157-73757179 TGGGGTCAGGGAGCTCTTCAGGG + Intergenic
1151676651 17:75602294-75602316 TGGGGAGAGTGTGGTCTTGCTGG + Intergenic
1151903130 17:77030643-77030665 TGGGCTCAATGGGGTCTTCTTGG - Intergenic
1152526925 17:80893669-80893691 CGGGGTCAGTGGGGTGCTCCCGG - Intronic
1152594170 17:81230213-81230235 TGCAGTCAGGGAGGGCTTCCTGG + Intronic
1152799044 17:82322643-82322665 TGGGGACAGTGAGAGCTTGCAGG + Intronic
1153139471 18:1954894-1954916 AGGGGTGAGTGGGGCCTTCCTGG + Intergenic
1153671246 18:7414577-7414599 AGAGTTCAGTGAGGCCTTCCTGG - Intergenic
1153897191 18:9575696-9575718 TGAGGTCAGTGAAGTTTTACTGG + Intronic
1153948652 18:10038649-10038671 AGGGGTCAGGGAAGGCTTCCTGG + Intergenic
1157522032 18:48352051-48352073 TAGGGTCAGGGAAGGCTTCCTGG - Intronic
1157576445 18:48746914-48746936 TGAGGTTAGGGAGGGCTTCCTGG - Intronic
1158616468 18:58992333-58992355 CGGGAGCAGGGAGGTCTTCCGGG - Intergenic
1158636842 18:59166344-59166366 TGTGGTCAGAGAGGTCATCTTGG - Intergenic
1159908399 18:74119523-74119545 TGGGGAGAGTGAGGGCTTCTAGG + Intronic
1160851568 19:1195333-1195355 TGGGGTCAGCGAGGGGTTCTAGG + Intronic
1160851992 19:1197147-1197169 TGGGGTCAGCGAGGGGTTCTAGG + Intronic
1160953756 19:1680024-1680046 TGGGGTCAGGGAGGGCTTCCTGG + Intergenic
1160955076 19:1687521-1687543 AGGGGTCAGAGAGGGCTTCCTGG + Intergenic
1161059395 19:2207502-2207524 TGGGGTGGGTGAGGTCTGCATGG + Intronic
1161585289 19:5102401-5102423 TGGAGACAGTGAGGCCTTCTAGG + Intronic
1162069352 19:8144491-8144513 GGGAGTCAGGGAGGGCTTCCTGG - Intronic
1162320917 19:9970229-9970251 TGGGGTGAGTGGGGTCTTTGGGG + Intronic
1162533357 19:11248571-11248593 AGGGGTCAGGGAGGACTTCCTGG - Intronic
1162925445 19:13928571-13928593 AGTGGTCAGGGAGGGCTTCCTGG - Intronic
1163761099 19:19137279-19137301 TGGAGTCTCAGAGGTCTTCCTGG + Intronic
1163827362 19:19531076-19531098 GGGAGTCAGCGAGGGCTTCCTGG - Intronic
1164683169 19:30149521-30149543 AGGGGTCAGGGAAGGCTTCCTGG + Intergenic
1165184064 19:34001768-34001790 TGGGGTCAGTGTCCTCTTCCAGG - Intergenic
1165198160 19:34122890-34122912 TGGGGTCAGTAAGGCCACCCAGG - Intergenic
1165245728 19:34497487-34497509 GGGAGCAAGTGAGGTCTTCCAGG + Intronic
1165461282 19:35945562-35945584 TGTGGTCAGGGAGGGCTTCCTGG + Exonic
1165493154 19:36136955-36136977 TGGAGACAGGGAGGTCTTTCTGG + Intergenic
1166219809 19:41357136-41357158 GGAGGTCAGAGAGGGCTTCCTGG - Intronic
1166557852 19:43713404-43713426 GGGAGTCAGGGAGGGCTTCCTGG - Intergenic
1166663089 19:44660008-44660030 GGGGGTCAGGGAGGGCTTCCTGG - Intronic
1166666013 19:44680906-44680928 AGGACTCAGTGAGGGCTTCCTGG - Intronic
1166673049 19:44722924-44722946 TGGGGTCAAGGAGGGCTTCCTGG + Intergenic
1166720088 19:44991527-44991549 TGGGGTCAGAGAGGACTTCAGGG + Intronic
1166742766 19:45124198-45124220 GGGGATCAGGGAGGGCTTCCTGG + Intronic
1166746137 19:45142675-45142697 GGGGGCCAGGGAGGGCTTCCAGG + Intronic
1166784422 19:45359140-45359162 GGGGGTCAGGGAGGGCTTCCTGG + Intronic
1166821212 19:45581438-45581460 GGGGTTCAGGGAGGGCTTCCTGG - Intronic
1166830451 19:45636462-45636484 TGGAGTCATGGAGGGCTTCCTGG - Intronic
1167008805 19:46792692-46792714 GGGGGTCAGGGAGAGCTTCCTGG + Intergenic
1167096235 19:47376326-47376348 AGGAGTCAGGGAGGGCTTCCTGG + Intronic
1167153391 19:47723063-47723085 GGGGGTCAAGGAGGACTTCCAGG - Intronic
1167334075 19:48873961-48873983 GGGGGACACGGAGGTCTTCCTGG - Exonic
1167429977 19:49448579-49448601 AGGGGTCAGGGAAGGCTTCCTGG - Intronic
1167599326 19:50445116-50445138 GGAGGTCAGGGAAGTCTTCCTGG + Intronic
926159666 2:10478599-10478621 TGGAGACAGGGAGGGCTTCCAGG - Intergenic
926219356 2:10924832-10924854 TGTGGTCAGAGAAGGCTTCCTGG - Intergenic
927631318 2:24776587-24776609 TGGGGACAGTGGGGGCTTCATGG - Intergenic
927879272 2:26679356-26679378 TGGGGTCATGGGGGACTTCCTGG + Intergenic
929917017 2:46144565-46144587 TGCAGGCAGTGAGGGCTTCCAGG - Intronic
930800408 2:55437878-55437900 AGGGGGAAGGGAGGTCTTCCTGG - Intergenic
932429927 2:71668032-71668054 TGGTGACAGGGAGGGCTTCCTGG + Intronic
932568136 2:72922290-72922312 TGGGGCCAGTGAGGTAGGCCAGG - Intronic
932604643 2:73156968-73156990 TGGGGGCAGTGAGGTTGACCTGG - Intergenic
933473990 2:82766040-82766062 TGGGGTCACAGAGGTCATTCCGG - Intergenic
933682740 2:85117383-85117405 TGGAGACAGTGAGATCTCCCTGG + Intergenic
933776637 2:85774923-85774945 TGGGGTCAGGGAGGGCTTTCAGG - Intronic
934463542 2:94237848-94237870 TGGGGTCTGTGAGGTAATTCAGG + Intergenic
935202805 2:100872816-100872838 AGGGATCAGGGAGGACTTCCTGG - Intronic
935321918 2:101897481-101897503 TGGGGACAGTCAGGGCTTCCAGG - Intergenic
935324116 2:101920508-101920530 GGGGGCCAGGGAGATCTTCCTGG - Intergenic
935728240 2:106042891-106042913 TGGGCACAGTGATGTCTTCCAGG + Intergenic
937262581 2:120595906-120595928 GGTGGTCAGGGAGGGCTTCCTGG + Intergenic
937309633 2:120894077-120894099 TGGGGACAGTCGGGTCCTCCTGG + Intronic
937861952 2:126718386-126718408 TGGGGCCAGTGAGCCCTTCCAGG + Intergenic
937888448 2:126916291-126916313 AGAGATCAGTGAGGACTTCCAGG - Intergenic
938228202 2:129635892-129635914 TGGGGCCAGTGGGGGCTTACAGG - Intergenic
939839802 2:147173206-147173228 TCGGGTCTGTCAGGTCTTCAGGG - Intergenic
941998787 2:171626494-171626516 TGGGGTCAGGGGGCACTTCCTGG - Intergenic
944092539 2:195928963-195928985 TGGGGTCTTTGAGGTTTTCTAGG - Intronic
1169957745 20:11124563-11124585 TGAGATCAGTGAGGTCAGCCGGG + Intergenic
1170983718 20:21239136-21239158 TGGGGACAGTAATGCCTTCCTGG - Intronic
1172164435 20:32890344-32890366 GAGGGTCAGGGAGGGCTTCCTGG - Intronic
1172186591 20:33034862-33034884 TGAGGGCTGTGAGGTCATCCTGG + Exonic
1172267777 20:33631563-33631585 TGGAGTCATTCAGGTCTTGCTGG + Intronic
1172871543 20:38138606-38138628 AGTGGTCAGAGAGGGCTTCCTGG - Intronic
1173041606 20:39469297-39469319 CGAGGTCTGTGAGGTCATCCAGG + Intergenic
1173326169 20:42035665-42035687 TCTGGTCAGTAAGTTCTTCCAGG + Intergenic
1173955792 20:47031557-47031579 TGGGGTCACTGAGATCTGGCAGG - Intronic
1173960881 20:47071761-47071783 TGGGGTCTTTGAGGTCTGACAGG - Intronic
1174039713 20:47690277-47690299 TGAGGTCTGTGAGGTAATCCTGG + Exonic
1174283368 20:49455118-49455140 TGAGGTCAGAGAGGTCTTGTAGG + Intronic
1174421891 20:50404681-50404703 TGGGGGCAAGGAGGGCTTCCTGG - Intergenic
1174773747 20:53324691-53324713 TGAGGTCAGCAAGGTCTTCACGG - Intronic
1175418285 20:58815955-58815977 TGGGGGCAGTGAGGGCTGCAGGG + Intergenic
1175680831 20:60987417-60987439 GGGGGTCAGGGAGAGCTTCCTGG + Intergenic
1175725459 20:61315225-61315247 TGGGGTCAGTGAGATGCTCATGG + Intronic
1175912431 20:62411228-62411250 TGGGGTCAGTGCCGTGTTCGGGG - Intronic
1175951197 20:62584288-62584310 GGTGGTCAGGGAGGACTTCCTGG + Intergenic
1175960001 20:62631200-62631222 TGGGGACAGGGGGGCCTTCCCGG + Intergenic
1176614563 21:9017242-9017264 TGGGGTGAGCCAGGTCCTCCTGG + Intergenic
1176692599 21:9934185-9934207 TGGGGTGGGTGAAGGCTTCCAGG - Intergenic
1176710641 21:10146632-10146654 TGGGGTGAGCCAGGTCTTCCTGG - Intergenic
1178067043 21:28916137-28916159 GGGGGTCAGTGACTTCTTCCAGG + Intergenic
1178302290 21:31463227-31463249 TGGGCTCAGTGGGCTCTTCTCGG - Intronic
1178518357 21:33266922-33266944 TGGGGTCAGGGAGGGCTGTCAGG - Intronic
1178823354 21:35994780-35994802 GGAGGGCAGTAAGGTCTTCCCGG + Intronic
1179195788 21:39161178-39161200 TGGGGTCAGAGTGCTCTTCTTGG - Intergenic
1179413466 21:41179505-41179527 TGGGGTGAGTGAGGGTGTCCAGG + Intronic
1179547356 21:42121822-42121844 TGTGGCCAGGGAGGGCTTCCTGG + Intronic
1180294729 22:10873782-10873804 TGGGGTGAGCCAGGTCCTCCTGG - Intergenic
1180497535 22:15903196-15903218 TGGGGTGAGCCAGGTCCTCCTGG - Intergenic
1180621413 22:17164966-17164988 TGGGGTCAGGAAGGGCTTGCAGG + Intronic
1181774540 22:25149905-25149927 GGGGGTCAGGGAAGGCTTCCTGG - Intronic
1181869281 22:25885390-25885412 TGGGGTCAGGGAGGGCTTCACGG + Intronic
1181903480 22:26174203-26174225 GGTGGTCAGTGAAGGCTTCCTGG + Intronic
1182105492 22:27686143-27686165 TGTGGTCAGGGAAGACTTCCTGG + Intergenic
1182287267 22:29255753-29255775 GGGGGTCAGGGAGGTCTTCCTGG + Intronic
1183496726 22:38150024-38150046 TGGGGTCAGGGAGGGCTTATAGG - Intronic
1183505905 22:38208748-38208770 AGGGATCAGGGAGGGCTTCCTGG + Intronic
1183670364 22:39269259-39269281 TGGGGTCAGGGAGGGCTCCCTGG - Intergenic
1183676457 22:39301555-39301577 GGGGGTCAGGGAAGGCTTCCAGG + Intergenic
1184059974 22:42075458-42075480 AGGGGTCAGGGAAGGCTTCCCGG + Intronic
1184090647 22:42291326-42291348 TGGGGTTAGACAGGGCTTCCAGG + Intronic
1184410923 22:44325928-44325950 AGGGGTCAGGGAGGGCTTCCTGG - Intergenic
1184436144 22:44478537-44478559 TGGGGTCAGGGATGTCTGCCAGG + Intergenic
1184644089 22:45886671-45886693 TGCAGTCAGGGAGGGCTTCCTGG - Intergenic
1184797167 22:46738908-46738930 TGGGGTCAAGGAGGCCTTCCTGG - Intergenic
1185011804 22:48318768-48318790 TGGGGCCAGAGAGGCCTTCTTGG - Intergenic
1185372208 22:50466167-50466189 TGGGGTCAACGCGGCCTTCCAGG - Exonic
949448448 3:4161382-4161404 TCAGGTCAGTGAGTTCTCCCAGG + Intronic
949495711 3:4629796-4629818 AGTGGTCAGGGAGGGCTTCCTGG + Intronic
949852591 3:8433861-8433883 GGTGGTCAGGGAGGACTTCCTGG - Intergenic
950074946 3:10180676-10180698 TGGAGTCATTGAGGGCTTCCAGG + Intronic
950171731 3:10843524-10843546 GGGGGTCAGGGAGAGCTTCCTGG - Intronic
950449035 3:13055239-13055261 GGGTCTCAGTGAGGTCTTCCTGG + Intronic
950531160 3:13553029-13553051 GGTGGTCAGGGAGGGCTTCCTGG + Intronic
950670936 3:14525054-14525076 TCGGGTCAGGGAGGGCTTCCTGG + Intronic
950978838 3:17280187-17280209 TGGGGGCAGGGAGGTCTGCAGGG + Intronic
951083404 3:18479746-18479768 TGAGGTGGGTGAGGGCTTCCAGG + Intergenic
951335826 3:21420536-21420558 TGGTGTCATGGAGGTCTCCCTGG - Exonic
951520423 3:23606130-23606152 TGGGGTCAGGGAAGCCTTCCTGG + Intergenic
952721013 3:36532659-36532681 AGTGGTCAGTGCAGTCTTCCAGG - Intronic
952970184 3:38645786-38645808 TGGGGTCAGGGAGGGCTGTCGGG - Intronic
953102526 3:39843729-39843751 AGGGGGCAGTGATTTCTTCCTGG - Intronic
954456012 3:50600263-50600285 TGCAGTCAGGGAGGGCTTCCTGG + Intergenic
954626451 3:52024476-52024498 TGAGGTTAGGGAGGGCTTCCTGG + Intergenic
954752727 3:52822879-52822901 GGGGATCAGGGAGGGCTTCCTGG - Intronic
954799497 3:53178964-53178986 TGAGGTCAGGGAGGACTTCCTGG + Intronic
954811001 3:53247820-53247842 TGTGGTCAGGGAGGGCTTCTTGG - Intronic
955415454 3:58687186-58687208 TGGGGGCTGGGAGGACTTCCTGG - Intergenic
955789827 3:62577117-62577139 TGAGGCCAGAGGGGTCTTCCAGG - Intronic
956252479 3:67249295-67249317 TGGAGTCAGGGGGGTCTTCAAGG + Intergenic
956908621 3:73793726-73793748 TGGAATCAGTTAGGTTTTCCTGG + Intergenic
956980818 3:74635078-74635100 TGAGGTCAGTGAGATCAGCCTGG - Intergenic
958000345 3:87741465-87741487 TGGGATCAGTGAACTCTACCAGG - Intergenic
958120769 3:89285265-89285287 TGGGCTCAGAGAAGTCTTCCTGG + Intronic
961471131 3:127113726-127113748 TTTTGTAAGTGAGGTCTTCCAGG + Intergenic
961519472 3:127458538-127458560 GGGGGTCAGAGAAGGCTTCCCGG - Intergenic
961830754 3:129621892-129621914 GGAGGTCAGAGAGGGCTTCCTGG + Intergenic
962252041 3:133841429-133841451 GTGGGGCAGTGAGGTCCTCCTGG + Intronic
962626312 3:137229112-137229134 AGGGGTCAGGGAGGGCTTCCTGG + Intergenic
962814778 3:138988089-138988111 CGGGGTCAGGGAAGGCTTCCTGG + Intergenic
963063194 3:141241497-141241519 TGGGGTCAGGGAAGGCTTCCAGG + Intronic
963580266 3:147117303-147117325 TGAAGTCAGTGAGTTCCTCCAGG + Intergenic
965742937 3:171895494-171895516 GGGGGTTATTGATGTCTTCCAGG + Intronic
968061518 3:195729691-195729713 TGGGGTCAGTGAGGTCTTCCGGG - Exonic
968598183 4:1496043-1496065 TGGGCTGCGTGAGGTCTTCCAGG + Intergenic
968877784 4:3283130-3283152 TGGGGGCAGTGAGGTAGCCCAGG - Intergenic
969096549 4:4736798-4736820 TGAGGTCAGGGAAGGCTTCCAGG + Intergenic
969235842 4:5864684-5864706 TGGGGTCAAGGAAGGCTTCCTGG + Intronic
969414780 4:7051177-7051199 GGGGGTCACTGAAGGCTTCCTGG + Intronic
969470098 4:7382509-7382531 TGGAGTCAATAAGGCCTTCCCGG - Intronic
969492358 4:7506761-7506783 TGTAGTCAGGGAGGGCTTCCTGG + Intronic
969525686 4:7702844-7702866 TGGCATCAGGGAGGGCTTCCTGG + Intronic
969623918 4:8292949-8292971 TGAGATCAGGGAGGGCTTCCTGG + Intronic
970475087 4:16414023-16414045 TTGAGTCCCTGAGGTCTTCCAGG - Intergenic
971262610 4:25070705-25070727 TGGGGGCAGGGAAGGCTTCCCGG - Intergenic
973544516 4:51967022-51967044 TGGGGTCAGTGGTGTAGTCCTGG + Intergenic
973807027 4:54536071-54536093 TGGGGGCAGTGGGGGGTTCCTGG - Intergenic
974523044 4:63010303-63010325 TGGGAGCAGTTAGGTCCTCCGGG + Intergenic
978150152 4:105424958-105424980 TGTGGTAAATGAGGTTTTCCTGG - Intronic
978833347 4:113116363-113116385 TGGGCTCAGCGAGGTTTTCCTGG - Intronic
980365183 4:131794397-131794419 TGGGGTGGGTGAAGGCTTCCAGG - Intergenic
980573285 4:134651404-134651426 TAGGGTCAGTCAAGTCTACCTGG + Intergenic
983050806 4:163045236-163045258 TGTGGTCAGGAGGGTCTTCCAGG - Intergenic
984609219 4:181819080-181819102 TGGTGTCAGAGAGGTCCTTCGGG - Intergenic
984732400 4:183080022-183080044 TGGGGTCAGACAGATCTTGCGGG - Intergenic
985534148 5:453863-453885 TGGCGACAATGAGGTCATCCAGG - Exonic
986707440 5:10463544-10463566 TGGGGTCCCTGAGGTCTTCCCGG + Intronic
987723935 5:21672557-21672579 TGGGACCAGTGAGGTAATCCAGG - Intergenic
988609646 5:32712430-32712452 GGGGGTCCACGAGGTCTTCCAGG + Exonic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
993016209 5:82537236-82537258 TGGAGTCTGTGAGCTCTTCAGGG + Intergenic
993076993 5:83244684-83244706 TGAGGTCATTGTGGTCTGCCTGG + Intronic
994226298 5:97254819-97254841 TCAGGGCAGTGAGGTCTCCCAGG - Intergenic
995011594 5:107261911-107261933 TTGGGTCAGGGATGGCTTCCTGG - Intergenic
996081996 5:119267540-119267562 GGGCGTCAGGGAGATCTTCCTGG - Intergenic
996448567 5:123588922-123588944 TGAGGTCAGTAAGGTTTTACTGG - Intronic
997505384 5:134412541-134412563 TGGGGTCAGGGAAGTGATCCTGG + Intergenic
997587462 5:135051926-135051948 TTGGCTCAGTCAGGGCTTCCAGG + Intronic
999452023 5:151685838-151685860 TGGGATGAGTTATGTCTTCCAGG - Intronic
1001217746 5:169871738-169871760 AGGGGACTGTGAGGTCATCCAGG - Intronic
1001449814 5:171815965-171815987 TGGGCTCTCTGAGGTCTGCCTGG - Intergenic
1002100412 5:176854905-176854927 TGGGGTCAGGGCAGGCTTCCTGG + Intronic
1002260023 5:177986537-177986559 TCGGGTCTCTGAGGCCTTCCGGG + Intergenic
1002772599 6:302501-302523 TGGGGTCGCAGAGGGCTTCCTGG - Intronic
1002792384 6:445967-445989 TGGGGTCACTGTGGGCTTTCAGG + Intergenic
1003065541 6:2901686-2901708 AGGAGTCAGGGAGGTCTCCCAGG - Intronic
1003086644 6:3065559-3065581 AGGAGTCAGGGAGGTCTCCCAGG + Intronic
1003171620 6:3725423-3725445 TGGGGCCAGTGGGGACTTCTGGG - Intronic
1004816763 6:19319459-19319481 TGGGTTAAGAGAGGACTTCCAGG - Intergenic
1004887677 6:20067336-20067358 GGGCGTCAGGGAGATCTTCCTGG - Intergenic
1006791060 6:36701595-36701617 GGGTGTCAGAGAGGGCTTCCTGG - Intronic
1007304655 6:40894511-40894533 GTGGGTCAGTGAGGCCCTCCAGG + Intergenic
1011945136 6:92890958-92890980 TGGGGTCAGAAAGGTCAGCCTGG + Intergenic
1012388731 6:98711667-98711689 TGTGGACTGTGAGGTTTTCCAGG - Intergenic
1016938233 6:149464319-149464341 TGGGGTCAGTGGGGTTTCGCTGG + Intronic
1017042254 6:150317070-150317092 TGGAGTCAGGGAGATCTTCTGGG - Intergenic
1017422228 6:154284428-154284450 ATGGGTCTGGGAGGTCTTCCTGG - Intronic
1018256431 6:161924280-161924302 GAGGATCAGTGAGGCCTTCCTGG - Intronic
1018316637 6:162562753-162562775 TCAGGGCAGTGAGGTCTGCCAGG - Intronic
1019484873 7:1284869-1284891 TGGGGTCAGGGAGGGCCACCAGG + Intergenic
1019540925 7:1550637-1550659 TGGGGTCAGTCGTGTGTTCCAGG + Intronic
1019709355 7:2511259-2511281 TGGGGTGAGGGTGGTCTGCCTGG - Intergenic
1019877460 7:3826919-3826941 TGTGGTGAGTGAAGTCTTGCTGG - Intronic
1020098523 7:5381465-5381487 GGTGGTCAGGGAGGGCTTCCTGG - Intronic
1023700127 7:42883928-42883950 TGGGGGCAGGGAGGCCTTCCTGG + Intergenic
1025248933 7:57338762-57338784 TGGGGGCAGGCAGGGCTTCCTGG + Intergenic
1026929382 7:74215414-74215436 TGGGGTGGGCGAGGGCTTCCGGG + Intronic
1027049054 7:75010185-75010207 TGTGGTCATGGAGGACTTCCTGG + Intronic
1027378362 7:77576951-77576973 TGGGGTCAGCCAGGCCTTCCAGG - Intronic
1027735020 7:81920887-81920909 TGGGGACAGGGGTGTCTTCCTGG + Intergenic
1029521369 7:101064762-101064784 TGGTATCAGAGAGGGCTTCCTGG - Intergenic
1029610646 7:101624899-101624921 TGGGGTCAGGGAAGGCTTCTCGG - Intronic
1029705909 7:102275483-102275505 TGCAGTCAGGGAGGGCTTCCTGG + Intronic
1031836361 7:126685484-126685506 AGGGGTCAGAGGGGCCTTCCTGG - Intronic
1032095287 7:128935169-128935191 TGGGGACAGGGAGGTCTGTCCGG - Intergenic
1032673422 7:134106653-134106675 TGTGCTGAGTGAGGTCTTCATGG - Intergenic
1032800446 7:135313387-135313409 TGGAGTCAGGGAGGGCTTCCTGG - Intergenic
1032921245 7:136550544-136550566 TGGGGCCAGTGGAGTCCTCCTGG - Intergenic
1033823227 7:145159042-145159064 TGGAGTCAGTGAGGCCTCCAGGG - Intergenic
1034429847 7:151035800-151035822 TGGGGACAGGGAGGAGTTCCGGG - Intronic
1035630355 8:1102943-1102965 TGGGGTCTCTGTGGTTTTCCGGG + Intergenic
1035630380 8:1103086-1103108 GGGGGTCTCTGAGGTTTTCCGGG + Intergenic
1036410067 8:8491695-8491717 CTTGGTCAGTGAGTTCTTCCTGG + Intergenic
1036771180 8:11579223-11579245 TGGGGTCAGGGGGGTCAGCCTGG + Intergenic
1036907530 8:12720015-12720037 TGGGGCCAGGGGGGGCTTCCAGG - Intergenic
1037034199 8:14145043-14145065 TCAGGTCAGTGAGGTCTCCTGGG - Intronic
1040041629 8:42921680-42921702 TTGGATCATTGAGGTTTTCCTGG + Intronic
1040303599 8:46200775-46200797 TGGGGTGAGAGAGGCCTTCTTGG - Intergenic
1040310868 8:46236180-46236202 TGGGATGAGTGAGATCTTCTTGG - Intergenic
1040443858 8:47473450-47473472 TGGGCTCTGTGAATTCTTCCTGG + Intronic
1041083703 8:54237261-54237283 TGGGGTCAAGAATGTCTTCCTGG - Intergenic
1041201431 8:55454287-55454309 CGGGGTCAATGCGGCCTTCCAGG - Intronic
1043539352 8:81242182-81242204 AGGGGTCAGGGAGGGCTCCCTGG + Intergenic
1047028030 8:120845832-120845854 TAGGTTCAGTGAGGTGTTACAGG - Intergenic
1047300721 8:123611709-123611731 TGGGGTCAGAAAGCACTTCCTGG - Intergenic
1047618162 8:126580359-126580381 AGGGGTTAGTGAGTTCTTCTTGG + Intergenic
1047889230 8:129289245-129289267 TGGTGTCCATGAGGTATTCCAGG + Intergenic
1048228755 8:132616442-132616464 TGGGGTCAGTGAGATGTGGCTGG + Intronic
1049028404 8:140013609-140013631 TGAGGTCAGTGATGTCCTTCGGG + Intronic
1049218738 8:141419237-141419259 TGGTGCCTGTGGGGTCTTCCTGG + Intronic
1049243443 8:141550079-141550101 TGGGGGCAGTGACGCCTGCCGGG - Intergenic
1049339246 8:142103130-142103152 TGGAGTCAAGGAGGGCTTCCTGG + Intergenic
1049719798 8:144110549-144110571 TGTGGTCCGTGGGGTCGTCCTGG - Exonic
1051915261 9:22200090-22200112 TGGGGGCACTGAGGTGCTCCTGG + Intergenic
1053020145 9:34688991-34689013 TGGGGTCAGGGAAGGCTTCCTGG + Intergenic
1053647626 9:40132328-40132350 TGGGGTGAGCCAGGTCCTCCTGG - Intergenic
1053758105 9:41331515-41331537 TGGGGTGAGCCAGGTCCTCCTGG + Intergenic
1053776225 9:41543297-41543319 TGGGGTGGGTGAAGGCTTCCAGG + Intergenic
1054328603 9:63730282-63730304 TGGGGTGAGCCAGGTCCTCCTGG - Intergenic
1054365507 9:64335193-64335215 TGGGGTGGGTGAAGGCTTCCAGG - Intergenic
1054536953 9:66243842-66243864 TGGGGTGAGCCAGGTCCTCCTGG + Intergenic
1054673138 9:67824906-67824928 TGGGGTGGGTGAAGGCTTCCAGG - Intergenic
1056774276 9:89499504-89499526 TGAGGACAGTGTGGTCGTCCTGG + Intergenic
1058667324 9:107332391-107332413 TAAGGTTAGTGAGGTCTTCTAGG + Intergenic
1059456674 9:114404118-114404140 TGGGGTCAGGGAGGGCTGCCTGG + Intronic
1059919632 9:119144421-119144443 TGGGGTCAGTGATGTGATCTCGG + Intergenic
1060488008 9:124061765-124061787 TGAGGTAACTGAGGGCTTCCAGG - Intergenic
1060662393 9:125411932-125411954 GGGTGTCAGTGAGCTCTTCCTGG - Intergenic
1061159575 9:128885470-128885492 TGGGGTCAGGGAAGGCTTTCTGG - Intronic
1061496665 9:130978698-130978720 TGCGGTCAGTGAGGTGCTGCGGG + Intergenic
1061903831 9:133686423-133686445 GGGAGTCAGGGAGGGCTTCCTGG - Intronic
1061937311 9:133864881-133864903 TGCGGTCTGTGAGCTCCTCCGGG + Intronic
1062060483 9:134492848-134492870 GGAGGTCAGAGAGGGCTTCCTGG + Intergenic
1062340793 9:136093166-136093188 TGTGGGCAGTGTGGTCTCCCAGG - Intronic
1202795401 9_KI270719v1_random:115620-115642 TGGGGTGAGCCAGGTCTTCCTGG - Intergenic
1203481098 Un_GL000224v1:10834-10856 TGGGGTCACTGAGGTATGCGTGG + Intergenic
1203482062 Un_GL000224v1:17143-17165 TGGGGTCACTGAGGTATGCGTGG + Intergenic
1203626938 Un_KI270750v1:33804-33826 TGGGGTAGGTGAGTTTTTCCGGG + Intergenic
1186347281 X:8706979-8707001 GGGGGTCAGGGAAGGCTTCCTGG - Intronic
1186506716 X:10099481-10099503 TGGGGTGAGGGAGTTCTTTCTGG + Intronic
1189893845 X:45633071-45633093 TCTGGTCAGTGAGCCCTTCCAGG + Intergenic
1190061967 X:47217549-47217571 TGGGGATAGTGTGGTTTTCCAGG + Intergenic
1190373777 X:49768163-49768185 AGGAGTCAGAGAGGTCTTCTTGG + Intergenic
1190486183 X:50927349-50927371 TGGGGCCACTGAGGTTTGCCTGG + Intergenic
1193210082 X:78797203-78797225 TTGGGGCTGTGAGTTCTTCCTGG + Intergenic
1193613972 X:83666344-83666366 TGGGGTGGCTGAGGTCATCCTGG + Intergenic
1193691892 X:84656441-84656463 TCAGGGCAGTGAAGTCTTCCAGG + Intergenic
1195079517 X:101357698-101357720 TGGGTTCATGGAGGTCTTCTGGG - Intronic
1195129873 X:101841207-101841229 CGGGGGCAGAGAGGTCTGCCTGG - Intronic
1195176363 X:102318616-102318638 CGGGGGCAGAGAGGTCTGCCTGG + Intronic
1195182501 X:102368477-102368499 CGGGGGCAGAGAGGTCTGCCTGG - Intronic
1197706490 X:129638196-129638218 TGGGGTCAGAGAAAGCTTCCTGG - Intergenic
1197774184 X:130109523-130109545 TCGGCTCAGCGAGGTCCTCCTGG - Intronic
1198018668 X:132636777-132636799 GGGGGTTAGTGAGTTCTTTCAGG - Intronic
1199987852 X:152965161-152965183 TGGGGTCACCGAGGTCTGCATGG + Intronic
1200067035 X:153508820-153508842 TGGGGACAGTGGGCTCTGCCAGG + Exonic