ID: 968062094

View in Genome Browser
Species Human (GRCh38)
Location 3:195733362-195733384
Sequence CTGTTGCCACATCTGGGGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 207}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968062094_968062108 18 Left 968062094 3:195733362-195733384 CCTGACCCCAGATGTGGCAACAG 0: 1
1: 0
2: 1
3: 8
4: 207
Right 968062108 3:195733403-195733425 CCGGAGTGTATGTGTGGGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 282
968062094_968062104 14 Left 968062094 3:195733362-195733384 CCTGACCCCAGATGTGGCAACAG 0: 1
1: 0
2: 1
3: 8
4: 207
Right 968062104 3:195733399-195733421 TCCACCGGAGTGTATGTGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 104
968062094_968062099 -1 Left 968062094 3:195733362-195733384 CCTGACCCCAGATGTGGCAACAG 0: 1
1: 0
2: 1
3: 8
4: 207
Right 968062099 3:195733384-195733406 GGACCCTCGCTCACATCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 79
968062094_968062102 12 Left 968062094 3:195733362-195733384 CCTGACCCCAGATGTGGCAACAG 0: 1
1: 0
2: 1
3: 8
4: 207
Right 968062102 3:195733397-195733419 CATCCACCGGAGTGTATGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 67
968062094_968062109 19 Left 968062094 3:195733362-195733384 CCTGACCCCAGATGTGGCAACAG 0: 1
1: 0
2: 1
3: 8
4: 207
Right 968062109 3:195733404-195733426 CGGAGTGTATGTGTGGGGAGGGG 0: 1
1: 0
2: 4
3: 43
4: 599
968062094_968062106 17 Left 968062094 3:195733362-195733384 CCTGACCCCAGATGTGGCAACAG 0: 1
1: 0
2: 1
3: 8
4: 207
Right 968062106 3:195733402-195733424 ACCGGAGTGTATGTGTGGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 268
968062094_968062103 13 Left 968062094 3:195733362-195733384 CCTGACCCCAGATGTGGCAACAG 0: 1
1: 0
2: 1
3: 8
4: 207
Right 968062103 3:195733398-195733420 ATCCACCGGAGTGTATGTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968062094 Original CRISPR CTGTTGCCACATCTGGGGTC AGG (reversed) Exonic
900928009 1:5718197-5718219 CGGGTGCCACATCTGGAGACAGG + Intergenic
902379037 1:16044019-16044041 CTGTGGCCTGAGCTGGGGTCAGG + Intronic
903679587 1:25088204-25088226 CTGTTTCCCCATCTGTGCTCTGG - Intergenic
903868847 1:26417959-26417981 CTGTTGCCACTTCTGGAGAAAGG + Intronic
904823168 1:33257955-33257977 CAGCTGCCACCTCTGGGGGCAGG - Intronic
906879347 1:49573900-49573922 ATGTTGCCACTACTGGGGTTGGG - Intronic
907335019 1:53694139-53694161 CTCTGGCCCAATCTGGGGTCAGG + Intronic
907413399 1:54297964-54297986 CTGTTTCCCCTGCTGGGGTCAGG - Intronic
912733672 1:112131400-112131422 ATGTTGCCACTACTGGGGACGGG + Intergenic
913078816 1:115363327-115363349 CTGTGGCCACATCTGGGTTCAGG - Intergenic
915888350 1:159747628-159747650 CCAGTGCCACATCTGGGGTTTGG + Intergenic
915953878 1:160207484-160207506 CTGATGCCCCATCTTGGGTCTGG + Intronic
916652625 1:166845544-166845566 CTGCAGCCACTTCAGGGGTCAGG - Intronic
917872555 1:179255044-179255066 CTGTTGCCAGGTCTGCGGTGAGG + Intergenic
918028719 1:180780996-180781018 CCATTGCCCCATCTGAGGTCAGG + Intronic
918957924 1:191235448-191235470 ATGTTGCCACTACTGGGGTTGGG - Intergenic
920312538 1:205057076-205057098 CTGGAGCCACATGTGGGGTGGGG - Intronic
922557245 1:226541809-226541831 CCGTGGCCGCCTCTGGGGTCTGG + Intergenic
924163334 1:241256610-241256632 GTGTTGCCATATCTGGTGTGTGG + Intronic
1066543376 10:36473886-36473908 ATGTTGCCACTACTGGGGTTGGG - Intergenic
1066985529 10:42462994-42463016 CTGTTGCCCCACCTGGAGTGTGG - Intergenic
1069729715 10:70602786-70602808 CTGTGACCACAGCTGGGGGCGGG - Intergenic
1069842072 10:71346141-71346163 CTGTTGCCTCTTCAGTGGTCTGG + Intronic
1070898141 10:80003414-80003436 CTGTTGCCTAATCTAAGGTCAGG - Intergenic
1073452362 10:103617466-103617488 CTGCTGCCACCTCTGGGGCCTGG - Intronic
1074028724 10:109663619-109663641 CCCTTGCCACATCTGCTGTCTGG + Intergenic
1076218250 10:128712862-128712884 CTGTGGCCACATGGGGGCTCGGG - Intergenic
1076691633 10:132226638-132226660 CAGGTGCCACAGCTGGGGGCAGG + Intronic
1077610588 11:3641441-3641463 CTGTACCCACATTTGGGGTAGGG + Intronic
1078558568 11:12351373-12351395 TTGTTGTCACATCTAGGGGCAGG + Intronic
1078665182 11:13318720-13318742 CTGTGGCCACATCTGGAGGGTGG + Intronic
1081368567 11:42268161-42268183 CTGTTGCCACACCCTGGGCCTGG - Intergenic
1084657312 11:70527122-70527144 CTGATTCCACAGCTGTGGTCTGG + Intronic
1089660232 11:119980887-119980909 CTGCAGCCACCTCTGGGGTGGGG - Intergenic
1090844262 11:130517842-130517864 GTGGTGCTACATCTGGGGTATGG - Intergenic
1091221456 11:133931997-133932019 GTGATGCCACCTCTGGGCTCTGG - Intronic
1094070480 12:26407430-26407452 CTGTTGTCACAACTGGGATGGGG - Intronic
1096090227 12:48894529-48894551 CTGGTGCCACATCTGGGCCTGGG - Intergenic
1096918936 12:55063361-55063383 CTCTGGCCACATCTGGTCTCAGG - Intergenic
1097697640 12:62790050-62790072 TTGTTGGCAGATCTAGGGTCAGG + Intronic
1098981287 12:76959519-76959541 CTGTTGCCAAGTCTGGAGTGCGG + Intergenic
1099401454 12:82207294-82207316 ATGTTGCCACCACTGGGGTTGGG + Intergenic
1100670233 12:96803505-96803527 CTGCTGCCACCAGTGGGGTCTGG + Intronic
1101848371 12:108382108-108382130 CCGTTGGCAAATCTGGGCTCTGG + Intergenic
1103888089 12:124217644-124217666 CTGTTTCCAGAGCTGGGGTGCGG - Intronic
1104800833 12:131554426-131554448 CTCTTGCTACATCTGGGGAGGGG + Intergenic
1105451115 13:20501269-20501291 CTGTTTCCTCATCTGGGATATGG - Intronic
1110209120 13:72952069-72952091 CTGTTGCCTCGTCTGGAGTGCGG + Intronic
1110246269 13:73327759-73327781 ATATTGCAATATCTGGGGTCAGG - Intergenic
1110654062 13:77975947-77975969 CTGGTGCCACACCCTGGGTCTGG - Intergenic
1111721951 13:91956590-91956612 CTGTTTCCACCACTGGGGCCTGG + Intronic
1112494246 13:99893251-99893273 CTGCTGCCCCGTCTGGGGTCTGG - Exonic
1112588709 13:100744081-100744103 CTGTTGCCCCATCTGTGGAATGG + Intergenic
1113237983 13:108302784-108302806 CTGTTGCCACATTTGGGCCAAGG + Intronic
1113440302 13:110323280-110323302 CTGTTGCACCCTCTGTGGTCAGG + Intronic
1119264519 14:73256070-73256092 CTGGTGCCTCAGCTGGGGCCTGG + Intronic
1120231752 14:81847849-81847871 ATGTTGCCACCACTGGGGTTGGG + Intergenic
1122960226 14:105090813-105090835 CTGTTTCCTCATCTGGGGAGTGG - Intergenic
1123899679 15:24863793-24863815 CTGTGGACACATCTGCGTTCTGG + Intronic
1127155670 15:56122633-56122655 CTCTGGACCCATCTGGGGTCTGG - Intronic
1128502559 15:68237449-68237471 CTGTTGCCCAAGCTGGGGTTTGG - Intronic
1128759068 15:70203076-70203098 CTATGGCCTCATTTGGGGTCTGG + Intergenic
1134899868 16:17927759-17927781 ATGCTGGCAGATCTGGGGTCTGG + Intergenic
1135267569 16:21040591-21040613 CTGTTGGATCATCTGAGGTCAGG - Intronic
1136551036 16:30982756-30982778 CTGCTGCCACTGCTTGGGTCGGG - Intronic
1138111202 16:54325403-54325425 CTTTCTCCACTTCTGGGGTCAGG - Intergenic
1138173256 16:54872862-54872884 CTGAAGCCACACCTGGGCTCAGG + Intergenic
1140998007 16:80279750-80279772 CTGGTGCCTCCTCTTGGGTCTGG - Intergenic
1141915513 16:87093949-87093971 CTGCTGCTGCATCCGGGGTCTGG - Intronic
1142279056 16:89138237-89138259 CTGATGGCACATTTGAGGTCAGG + Intronic
1143119737 17:4599388-4599410 CGGTTGCCACGTCTGGGCTTCGG - Intronic
1144132741 17:12263849-12263871 CTGCTGCTACAACTGGGGTATGG + Intergenic
1144386083 17:14750520-14750542 GTGTTCCCACACCTGGGCTCTGG + Intergenic
1145782201 17:27570742-27570764 CTGTGGCCACATCTGCCTTCTGG + Intronic
1145973054 17:28968197-28968219 CTGTTCCCATCTCTGGGATCAGG + Intronic
1146351790 17:32101567-32101589 CGGTTTCCACATGTGGAGTCTGG + Intergenic
1146840840 17:36153104-36153126 CTGGAGCAACATCTGGGGGCTGG + Intergenic
1147910479 17:43853208-43853230 CTGTGACCACTTCTGGGATCTGG - Intronic
1148755252 17:49969771-49969793 CTCTTCCCACCTCTGGGGTTCGG + Intronic
1149869202 17:60167712-60167734 CGGTTTCCACATGTGGGATCTGG + Intronic
1150371117 17:64638936-64638958 CTGTGGGCACTTTTGGGGTCTGG - Intronic
1150813286 17:68373601-68373623 CTGTGGCCATATCTTGTGTCTGG + Intronic
1152448841 17:80363670-80363692 CTGTAGCCACGCCTGGGGACTGG - Exonic
1153247120 18:3083035-3083057 CGGTTAACACATCTGTGGTCTGG - Intronic
1156458286 18:37306976-37306998 CGTTTGCCACCTCTGTGGTCTGG + Intronic
1158664569 18:59420845-59420867 CTTCTCCCACAGCTGGGGTCAGG + Intergenic
1159485946 18:69057431-69057453 CTGATACCTCATCTGGGGTGAGG + Intergenic
1161027694 19:2044234-2044256 CTGTGGCCACATGTGAGGTGGGG - Intronic
1161454177 19:4361932-4361954 CCCCTGCCACTTCTGGGGTCCGG + Intronic
1163205301 19:15798280-15798302 CTGTTTCCACACCTGGGGCATGG - Intergenic
1163486612 19:17591324-17591346 CTGTTTCCACATCTGGCTGCTGG + Intergenic
1164812475 19:31168640-31168662 CTTTTGGCACATCTGAGGTGGGG + Intergenic
1164920757 19:32086878-32086900 CTGTTGCCCCATCTGGTGAATGG + Intergenic
1165000221 19:32755004-32755026 CTGTTGCCACCTTTGGGAGCTGG - Intronic
1166995635 19:46718478-46718500 CTGTCACCACATCCGGGGGCTGG + Intergenic
1167412705 19:49354465-49354487 CTGTTGCCTAAGCTGGGGTGCGG - Intronic
925719455 2:6813341-6813363 CTGTTGCCTGATCTCTGGTCAGG - Intergenic
927401339 2:22715522-22715544 CAGTTGCCAAGTCTGGAGTCTGG + Intergenic
934681915 2:96290191-96290213 CTGCACCCACATCTTGGGTCTGG - Intronic
935001386 2:99019595-99019617 CTGTCCTCACATCTGAGGTCAGG - Intronic
938856048 2:135312233-135312255 CTGTTGCCAAAGCTGGAGTGCGG + Intronic
941279924 2:163537158-163537180 CTGGTGACACATCTGAGGTATGG - Intergenic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
941739250 2:169015510-169015532 CTGTTCCCACCTCTGGGTGCGGG + Intronic
942318959 2:174719068-174719090 CTGTTGCCCCATCAGGGTCCTGG + Intergenic
942623813 2:177877390-177877412 CTTGTGCCTCATCTGGGGTGAGG - Intronic
943916725 2:193644308-193644330 CTGTTTCTACATCTGAAGTCAGG + Intergenic
945044958 2:205773879-205773901 CTGCTCCCACCTCTGTGGTCTGG + Intronic
946528205 2:220542561-220542583 ATGTTGCCACTACTGGGGACAGG + Intergenic
946585288 2:221179655-221179677 CTGTTGCCACATCTTCCATCTGG + Intergenic
1168837319 20:885845-885867 CTCTTGCCACACATGGGGTTAGG - Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1174253869 20:49239474-49239496 ATGTTTCCACATTTGGGGTGTGG + Intronic
1174629712 20:51945738-51945760 CTGTTGCCAAGGCTGGGGTGTGG + Intergenic
1175857491 20:62130146-62130168 CTGCTTCCACAGCTGGGTTCTGG + Intronic
1176199825 20:63855252-63855274 CTGTGGCCACAGCTGGGGGGAGG - Intergenic
1176521826 21:7830053-7830075 GTGTGGCCACAGCTGGGGTGCGG - Intergenic
1178024751 21:28453550-28453572 CTGTTGACCCATCTCGGGGCAGG - Intergenic
1178064069 21:28884681-28884703 CTGTAGCCACATGTGAGGACTGG + Intronic
1178655846 21:34460065-34460087 GTGTGGCCACAGCTGGGGTGCGG - Intergenic
1179645407 21:42772225-42772247 TTGGTGCCTCATCTGGGGCCTGG - Intronic
1179822079 21:43942829-43942851 CCATTGCCTCATCTGGGCTCAGG + Intronic
1182500549 22:30743588-30743610 CTGCTGGCACAGCTGGGCTCAGG + Intronic
949208803 3:1473537-1473559 CTGATTCCACAACCGGGGTCTGG + Intergenic
950046236 3:9950048-9950070 CTGCTGCCACTCCTGGGGACTGG - Exonic
952174684 3:30848958-30848980 TTCTTCCCACATCTTGGGTCTGG + Intronic
952327568 3:32335002-32335024 CTGCTGGCACATTTGGGGGCTGG + Intronic
953905612 3:46866995-46867017 CGGTTTCCTGATCTGGGGTCTGG - Intronic
955339371 3:58113216-58113238 ATGTTCACACCTCTGGGGTCTGG + Intronic
955770548 3:62380630-62380652 CTGTTTCCCGATCTGGGTTCTGG + Intergenic
956377247 3:68627841-68627863 TTGTTGCCAGATCTGGGCTCTGG - Intergenic
957247882 3:77735933-77735955 ATGTTGCCACTACTGGGGTTGGG + Intergenic
959949712 3:112165855-112165877 CAGATGCCACCTCTGGGGGCAGG - Intronic
960828710 3:121821025-121821047 CTGTTGCCAAAGCTGGTGTGCGG + Intronic
961406309 3:126682205-126682227 CAGTTTCCCCATCTGGGCTCAGG + Intergenic
961655354 3:128438771-128438793 GTGTCTCCACATCTGGGCTCTGG + Intergenic
962597159 3:136957906-136957928 CTGATGCAACATCTGGGTTTGGG + Exonic
963514664 3:146293488-146293510 TAGATGCCACCTCTGGGGTCAGG - Intergenic
966933273 3:184689604-184689626 CTGTTGCCCCATCAGGGCTGTGG - Intergenic
968062094 3:195733362-195733384 CTGTTGCCACATCTGGGGTCAGG - Exonic
968963456 4:3757538-3757560 CTTTGGCCACAGCTGGGGACAGG + Intergenic
969711626 4:8847631-8847653 CTGTTTCCACATCTGTGACCTGG - Intronic
971472718 4:27044011-27044033 CTGTGGCCAAATCTGGCTTCTGG + Intergenic
971727611 4:30333864-30333886 CTGGTGGAACATCTGAGGTCAGG - Intergenic
973092656 4:46157725-46157747 ATGTTGCCACTACTGGGGACAGG - Intergenic
973936742 4:55853893-55853915 CTGTCTCCACGCCTGGGGTCGGG + Exonic
974479366 4:62423460-62423482 ATGTTGCCACCACTGGGGTTGGG + Intergenic
975503976 4:75117783-75117805 CTCTTGACCCATCTGGGGCCTGG + Intergenic
975839012 4:78454761-78454783 CTCTTAACACAGCTGGGGTCAGG - Intronic
977150956 4:93510971-93510993 CTGTTGCCAAAACTGGAGTGCGG + Intronic
978568625 4:110112210-110112232 CTTTTGCCACATCTGCCCTCAGG - Intronic
980601817 4:135036879-135036901 ATGTTGCCACTACTGGGGTTAGG - Intergenic
981443271 4:144806930-144806952 CTGCTGCCACCACTGGGTTCTGG + Intergenic
988233614 5:28509684-28509706 ATGTTGCCACTTCTGGGGATGGG + Intergenic
990863379 5:60353138-60353160 CTGCTGCCTCTTCTGGGATCAGG + Intronic
992762019 5:79958909-79958931 GTGTTGGCAGATCTGGTGTCTGG - Intergenic
995907350 5:117141527-117141549 CAGTTGCCTCATCTGTGGTATGG + Intergenic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
998348965 5:141488495-141488517 CTCATTCCACATTTGGGGTCTGG + Intronic
1000083354 5:157867925-157867947 CTGTGGCCACTGCTGGTGTCAGG + Intergenic
1002160840 5:177313080-177313102 GTGGGGCCACATCTGGGGACAGG + Intergenic
1002194822 5:177496156-177496178 CTGTGGCCACCTCTGAGGGCTGG - Intronic
1002872336 6:1178142-1178164 GTGCTGCTACAGCTGGGGTCTGG + Intergenic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1003393081 6:5729966-5729988 TGGTTGTCACAACTGGGGTCAGG - Intronic
1003545450 6:7054197-7054219 CTGTTGCCTCAGCTGGAGTGCGG - Intergenic
1003971036 6:11299403-11299425 CAGATTCCACCTCTGGGGTCAGG + Intronic
1006716113 6:36121604-36121626 CTGTTGCCACACCTGTGCTCGGG + Intergenic
1007927431 6:45661889-45661911 CTGTTCCTTCATCTGGTGTCTGG - Intronic
1008227424 6:48937188-48937210 CTGTGGCCACTTCTGGGGGATGG + Intergenic
1009308304 6:62119699-62119721 ATGTTGCCACCACTGGGGGCAGG - Intronic
1014812584 6:125903302-125903324 CCTCTGCCACACCTGGGGTCTGG + Intronic
1015475390 6:133654720-133654742 ATGTTGCCACTACTGGGGTTGGG - Intergenic
1015484497 6:133753097-133753119 ATGTGGCCACATCAAGGGTCAGG - Intergenic
1018039740 6:159911369-159911391 CTGTTGCCCCAGCTGGAGTGCGG + Exonic
1018370382 6:163162769-163162791 CTCTTGCCAGCTCTGGGGGCTGG - Intronic
1018695235 6:166385721-166385743 CTGTTGCCACCACTGGGCTGGGG + Intergenic
1019728760 7:2617925-2617947 CTGCTGCCACATCTGCAGTGAGG + Intergenic
1020376437 7:7492546-7492568 CTGTTGCCAAAGCTGGAGTGTGG - Intronic
1024034295 7:45494765-45494787 CTGGTGACACCTCTGGGTTCAGG - Intergenic
1024210847 7:47202251-47202273 CTGTAGGCACCTCTGAGGTCAGG - Intergenic
1026952944 7:74359797-74359819 CTCTGTCCCCATCTGGGGTCTGG + Intronic
1028541855 7:91951359-91951381 CTGTTGCCCCAGCTGGAGTGTGG + Intronic
1028641459 7:93046406-93046428 CTGATGCCGCCTCTGGAGTCTGG + Intergenic
1031078754 7:117238645-117238667 CTGCTGCCTCTTCTGAGGTCTGG + Intergenic
1031627168 7:124004720-124004742 CTGGTGACACCTCTGGGTTCTGG - Intergenic
1033019465 7:137708016-137708038 CTGATGCCATATCTGCTGTCAGG - Intronic
1035477028 7:159151081-159151103 ATGTTGGCACACCTGGGATCAGG + Intergenic
1036646627 8:10614956-10614978 CTTTTGCCACATGTTGGCTCAGG - Intronic
1037684942 8:21130673-21130695 CTGTTGGCACCTCTGGGTCCTGG + Intergenic
1040103468 8:43525149-43525171 CTGGCGCCACATCCTGGGTCTGG - Intergenic
1040279316 8:46030382-46030404 ATGTTGCCAGAGCTGGGCTCAGG - Intergenic
1040350660 8:46563689-46563711 CTGTTGCCCAGTCTGGGGTAGGG - Intergenic
1048206421 8:132418747-132418769 CTGTTGCCCAAACTGGAGTCCGG - Intronic
1051696827 9:19776895-19776917 CTATTGCCACATCTGGAATGTGG - Intronic
1052033605 9:23656261-23656283 CTCCTACCACATCTGGAGTCAGG + Intergenic
1052760052 9:32581054-32581076 CTGTTGCCCCATCTGGTGTGTGG + Intergenic
1053411636 9:37919652-37919674 CTGTTGCCACTTACGGGGGCTGG - Exonic
1055110750 9:72556917-72556939 TGGTTGTCACATCTGGGGTTGGG + Intronic
1055387338 9:75776351-75776373 CTCTGGACCCATCTGGGGTCTGG + Intergenic
1056781775 9:89555955-89555977 CTGCTGCCAGAACTGGGGTAGGG - Intergenic
1058698882 9:107584764-107584786 CTGCCTCCACATCTGGAGTCAGG - Intergenic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1061117015 9:128620216-128620238 CTGCTTCCACATCTGGGGGCAGG - Intronic
1187251665 X:17604432-17604454 CTGTTACCACATTTGGGATTGGG + Intronic
1187339519 X:18408802-18408824 CTGTTGCTGAATATGGGGTCTGG + Intergenic
1187971366 X:24662353-24662375 TTGTTGTCACATCTTGGGGCTGG + Intronic
1192872781 X:75200555-75200577 CTGTTGCCAAGGCTGGGGTGCGG - Intergenic
1193858901 X:86640027-86640049 CTGATGACACCTCTGGGTTCTGG + Intronic
1194235658 X:91380633-91380655 ATGTTGAAACTTCTGGGGTCTGG + Intergenic
1195151872 X:102079709-102079731 CTGATTCCAGATCTGGGATCAGG + Intergenic
1196154106 X:112407548-112407570 CTCTTGACACACCTGGGGCCTGG + Intergenic
1197074402 X:122337508-122337530 ATGTTGCCACTACTGGGGTGGGG + Intergenic
1197515797 X:127426737-127426759 CAGTTGCCACAACTAGGGGCAGG - Intergenic
1199228131 X:145403626-145403648 CTGTTGGATCATCTGAGGTCAGG + Intergenic
1200117824 X:153776883-153776905 CTGTTGCTCCATCTGGGACCTGG - Exonic
1200323663 X:155216130-155216152 CTGCTGCCAGTTCTAGGGTCGGG + Intronic