ID: 968062587

View in Genome Browser
Species Human (GRCh38)
Location 3:195737345-195737367
Sequence AGAGCCCACTGAAAGTTTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968062587_968062591 -6 Left 968062587 3:195737345-195737367 CCCCGAAACTTTCAGTGGGCTCT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 968062591 3:195737362-195737384 GGCTCTGAAAGTTAAGAAAAGGG 0: 1
1: 0
2: 4
3: 25
4: 402
968062587_968062590 -7 Left 968062587 3:195737345-195737367 CCCCGAAACTTTCAGTGGGCTCT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 968062590 3:195737361-195737383 GGGCTCTGAAAGTTAAGAAAAGG 0: 1
1: 0
2: 1
3: 33
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968062587 Original CRISPR AGAGCCCACTGAAAGTTTCG GGG (reversed) Intronic
900994206 1:6111693-6111715 AGAGCCCTCTGAGAGCTCCGGGG - Intronic
901025022 1:6274601-6274623 AGAGCCTTCTGAAAGTTGTGTGG + Intronic
905503937 1:38461610-38461632 AGAGCCCTCTAAAAGAATCGGGG + Intergenic
907222230 1:52915353-52915375 AAAGGCCAATGAAAGTTTCTGGG + Intronic
910221481 1:84893196-84893218 AGAGCCAAAGGAAAGTTTGGCGG + Intronic
1066796022 10:39121829-39121851 AGAGCCCACTGAAAACTAAGGGG + Intergenic
1068747018 10:60544207-60544229 AGAGCCCACTTAATGTGTCCTGG + Intronic
1085841423 11:80015816-80015838 CGAGGCCACTGAAAGTTTCCTGG - Intergenic
1091077053 11:132629038-132629060 AGAGCCCACTGAAATTATTCAGG + Intronic
1093259906 12:16923080-16923102 AGAGCCCACAGTATGTTTGGGGG + Intergenic
1096636903 12:52965788-52965810 AGAGCCCACCGAGAGTTCTGGGG + Intergenic
1097271290 12:57776109-57776131 AGAGGCCACTGAAAGATTTGGGG - Intronic
1099615683 12:84932528-84932550 AGATCCAACTGAAAGTTTTCAGG + Intergenic
1100428496 12:94509291-94509313 AGGGGCCACTAAAAGTTTGGGGG - Intergenic
1107641706 13:42450570-42450592 AGACCCTGCTGAAAGTTTCTTGG + Intergenic
1108772105 13:53716258-53716280 ATAGGCCACTGAAAGTTACTTGG + Intergenic
1112085890 13:96032516-96032538 AAAGCCCAATGAAATTTTCATGG + Intronic
1114814926 14:25945804-25945826 AGAGCCAACTTAAATTTTCCTGG + Intergenic
1119944693 14:78680874-78680896 ATAGCCCACTGAAAATATCAGGG - Intronic
1121689824 14:95869511-95869533 AAAGACCACAGAAAGTGTCGGGG - Intergenic
1122656958 14:103268492-103268514 AGAGACCACAGAAAGCTTTGTGG + Intergenic
1122785208 14:104160359-104160381 AGAGGCCACTGAAAGGATCAGGG - Intronic
1123938061 15:25203537-25203559 AGAGCTCACTGAAAGAATCAAGG - Intergenic
1126117731 15:45224282-45224304 AGAGCCCATTGAAAATTGCTGGG - Intergenic
1127577631 15:60307511-60307533 TGAGCCCACTGGAGGTTTTGAGG + Intergenic
1131463457 15:92636540-92636562 AGGCCCCACTGAAAGTCTCCTGG - Intronic
1132609959 16:810718-810740 AGAGCCCACTGGACGTCCCGGGG - Intronic
1138746752 16:59371709-59371731 AAAGCACACTGAAATTTTAGTGG + Intergenic
1142621537 17:1168593-1168615 TGAACCCACTGAAGGTTTCTGGG + Intronic
1147305898 17:39564229-39564251 AGAGCCCATAGAAAGGTTGGGGG - Intronic
1148261990 17:46192669-46192691 AGAGGCCATTTAAAGTTCCGGGG + Exonic
1149864088 17:60140736-60140758 ATAGCTCACTGAAACTTTCTGGG - Intergenic
1152718194 17:81909892-81909914 GGAGCCCACTGAAAGCTGCAGGG + Intronic
1152914424 17:83025988-83026010 AGAACTCACAGAAAGTTTCAAGG - Intronic
1154076773 18:11211040-11211062 GGAGCCCAAGGAAATTTTCGGGG + Intergenic
1163031369 19:14546217-14546239 AGATCACACTGAAAGTTTTTGGG + Intronic
931757345 2:65385700-65385722 AGAGCTCATTTAAAGTTTCTAGG - Intronic
932870458 2:75393445-75393467 AGAGCCCACCCAAAGTGTCCAGG + Intergenic
935387821 2:102519781-102519803 AAGGCCCACTGATAGTTTTGTGG + Intronic
935949862 2:108318912-108318934 AGGCCACACTGAAAGTTTAGAGG + Intergenic
937336968 2:121068116-121068138 AGAAACCCCTGAAAGTTTGGGGG + Intergenic
938159528 2:128972991-128973013 AGAGCCCCCTGAAAGTACCTCGG - Intergenic
942147339 2:173039749-173039771 ATATCCCACTGAAAGTTAAGGGG + Intronic
942173700 2:173310983-173311005 ACAGCCAACTGAGAGTTTCCTGG - Intergenic
945160106 2:206881617-206881639 AGAGCCCAATGACAGTTTTTAGG + Intergenic
1168949717 20:1788604-1788626 ACTGTCCACTGAAACTTTCGGGG + Intergenic
1169843483 20:9965083-9965105 AGAGACCACTGAAACGTTCCAGG + Intergenic
1172329658 20:34066473-34066495 AGAGCCCTCTTACAGTTTCATGG + Intronic
1181381217 22:22506138-22506160 AGAGCCCAAGGAAAGTTCCGAGG + Intronic
1182044607 22:27264420-27264442 AGAGGCCACTGCAGGTATCGTGG + Intergenic
1182455984 22:30450834-30450856 AGAGCCCACCTACAGTTTCAGGG - Intronic
1184355045 22:43974241-43974263 AGAGCACACTTAAAGCTTCCTGG - Intronic
949716185 3:6934188-6934210 ATACCACACTGAAAGTTTCAAGG - Intronic
953215360 3:40913197-40913219 TGAGCTCACTGACAGTTTCACGG - Intergenic
953335310 3:42089425-42089447 GGAGCTCACTGGAAGTTTGGAGG - Intronic
954334136 3:49906357-49906379 AGATCCCTCTGAAAGTCTGGAGG - Intronic
954964395 3:54597433-54597455 AGTGCCCACTGAGACTTTCAGGG - Intronic
955554655 3:60123737-60123759 AGTGCCCACTTTAAGTTTAGTGG + Intronic
956215275 3:66842437-66842459 TGAGCCCACTGAAAGTCAAGGGG + Intergenic
956283100 3:67579564-67579586 AGACCCCTCTGCAAGTTTCTTGG - Intronic
956797886 3:72732556-72732578 AGAGGGCACTGAAAGTTACATGG - Intergenic
956798282 3:72735560-72735582 AGAGGGCACTGAAAGTTACATGG + Intergenic
958732210 3:97972055-97972077 CGAGCGCACGGAAAGTTTGGAGG - Exonic
961960542 3:130849605-130849627 AGAGAGCACTGCAAGTTGCGGGG - Intergenic
965247973 3:166299947-166299969 AGAGCACAGTGAAAGTGTCTTGG - Intergenic
967993955 3:195152977-195152999 AGAGCCCACTGCCAGTTCCATGG + Intronic
968062587 3:195737345-195737367 AGAGCCCACTGAAAGTTTCGGGG - Intronic
968447728 4:660732-660754 AGATCCCACAGGAAGTTTAGAGG + Intronic
971506653 4:27373727-27373749 AGAAGCCACTGAAAGTTTTCTGG - Intergenic
974003470 4:56533222-56533244 AGAGCCCACTTGAAGTTCAGGGG - Intronic
980133876 4:128842038-128842060 AGAGCCAACTGGAATTTTCATGG + Intronic
987374419 5:17219632-17219654 AACGCCCACTGACAGTTTTGAGG - Intronic
990521254 5:56583716-56583738 AGAGACCAAGGCAAGTTTCGGGG + Intronic
990729510 5:58793144-58793166 AGGGCCCACTGAGAGGTTTGAGG - Intronic
990996853 5:61741013-61741035 AGAGCCCCCTTAGAGTTTGGAGG + Intronic
997010065 5:129866175-129866197 AGAGCACAAGGAAACTTTCGGGG + Intergenic
999478708 5:151925268-151925290 AGAGCCCAGGGCAAGTTTCAGGG + Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1015355493 6:132272838-132272860 GGAGCCCACTCAAAGCTTCATGG - Intergenic
1017079383 6:150653159-150653181 ATAGGCCACTGAAAGTATCATGG - Intronic
1024375472 7:48633004-48633026 AGAATCCACTGACAGTTTCAAGG - Intronic
1025627276 7:63233370-63233392 AGAAGCCACTGAAGGCTTCGTGG - Intergenic
1031947041 7:127853133-127853155 AGACCCCACTGAAATTGTCGAGG + Intronic
1031961616 7:127995212-127995234 AGAGCCAACTTAAATTTTCAGGG - Intronic
1035879108 8:3224527-3224549 AGAGCTCACTTAAACTTTTGGGG - Intronic
1044357925 8:91246469-91246491 AGAAACCAGGGAAAGTTTCGTGG + Intronic
1048072343 8:131035309-131035331 TGAGCCTTCTGAAAGTTTCTCGG + Intronic
1048267131 8:132997651-132997673 AGAGCCCTTTGAAAATTTAGTGG + Intronic
1049169197 8:141148116-141148138 AGAACCCACTGCAAGCTTAGAGG + Intronic
1052470207 9:28884222-28884244 AGAGCAGACTGAAAGTTTACAGG - Intergenic
1053224197 9:36338040-36338062 AGAGCCAACTGAAAGTTGAGTGG + Exonic
1057777721 9:98024499-98024521 AGAGCACACAGGAAGTTTCAGGG - Intergenic
1058707742 9:107651186-107651208 AGAGGCCACCACAAGTTTCGGGG - Intergenic
1060560619 9:124539823-124539845 AGAGACCACTGACATTTTCAAGG + Intronic
1061964771 9:134006967-134006989 GGAGCCCAGTGAAAGTCTCTGGG - Intergenic
1186166013 X:6826886-6826908 AGAGCCCACAGACAGTTAAGGGG - Intergenic
1195130631 X:101847451-101847473 AGAGCCCACTCAAAGTCTGGTGG - Intronic
1195898855 X:109776431-109776453 TGAGACCACTTAAAGTTTTGCGG - Intergenic
1198625458 X:138567483-138567505 ACAACCCACTGACAGTTTGGGGG - Intergenic
1200684965 Y:6249910-6249932 AGAGGCCACAGAAAATTTAGGGG - Intergenic
1200990495 Y:9341180-9341202 AGAGGCCACAGAAAATTTAGGGG - Intergenic
1200993157 Y:9361497-9361519 AGAGGCCACAGAAAATTTAGGGG - Intronic
1200995811 Y:9381768-9381790 AGAGGCCACAGAAAATTTAGGGG - Intergenic
1200998475 Y:9402120-9402142 AGAGGCCACAGAAAATTTAGGGG - Intergenic
1201000985 Y:9470650-9470672 AGAGGCCACAGAAAATTTAGGGG - Intronic
1201003652 Y:9490978-9491000 AGAGGCCACAGAAAATTTAGGGG - Intergenic
1201006308 Y:9511259-9511281 AGAGGCCACAGAAAATTTAGGGG - Intergenic
1201008966 Y:9531569-9531591 AGAGGCCACAGAAAATTTAGGGG - Intergenic