ID: 968062981

View in Genome Browser
Species Human (GRCh38)
Location 3:195740064-195740086
Sequence CCAACCATCCATCAGTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968062981 Original CRISPR CCAACCATCCATCAGTTGTG AGG (reversed) Intronic
903339263 1:22643870-22643892 CCCACCATCCATCCATGGTGAGG + Intronic
903696347 1:25210284-25210306 CCAACCACCAATCAATTCTGTGG + Intergenic
908028625 1:59976260-59976282 CCTAGCATCTATCAGTTGTTTGG + Intergenic
908264843 1:62368326-62368348 GAAAGCAACCATCAGTTGTGAGG - Intergenic
908564986 1:65345163-65345185 ACAACCTTCCATCAGTTCAGTGG - Intronic
916943494 1:169700661-169700683 CCAACCATCCGTCACTGGAGAGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
1064707073 10:18084226-18084248 CCAACCATTTATCATCTGTGTGG + Intergenic
1074715370 10:116213676-116213698 CCAAGGGTCCATCAGTGGTGTGG + Intronic
1080315712 11:30945868-30945890 CCACCCATCCATTAGGTGGGTGG + Intronic
1089988493 11:122835881-122835903 CAAACTAGCTATCAGTTGTGAGG + Intergenic
1106033170 13:26020679-26020701 CCAGCCATGCAGCAGGTGTGGGG - Exonic
1107618306 13:42196395-42196417 CCAAACATCCATCAGTTGAATGG + Intronic
1108517722 13:51218728-51218750 CCACCCACCCACCAGTTGTTGGG + Intergenic
1109564280 13:64091022-64091044 CCTACCATCTACCAGTTGTACGG + Intergenic
1113913268 13:113854775-113854797 CCTCCCATCCAACAGCTGTGTGG - Intronic
1118595656 14:67433190-67433212 GCAGCCATCCATCAGCTCTGAGG - Intergenic
1118703954 14:68462541-68462563 CCAACTATCCATCAATTCTTTGG - Intronic
1120723112 14:87908539-87908561 CAAACCATCCATTTGTTGTTTGG + Intronic
1121320472 14:92988933-92988955 CCAACCCTCCGCCAATTGTGTGG - Intronic
1126666571 15:51080891-51080913 CAAACCATCCATCAAGGGTGTGG - Intronic
1126959519 15:53975853-53975875 CCAACCATCTATAAGTTTTGAGG + Intergenic
1131009150 15:89002971-89002993 CCCACCAGCCATGAGATGTGTGG + Intergenic
1132248902 15:100318763-100318785 TCAACAATCCAGCAGTTGTTGGG + Intronic
1136603592 16:31315180-31315202 TTAACCATTTATCAGTTGTGTGG + Intronic
1139633781 16:68245878-68245900 CCCACCATCCCTCAGGAGTGGGG - Intronic
1140966908 16:79975768-79975790 CCTACCATCTATTATTTGTGTGG - Intergenic
1141147853 16:81544141-81544163 CCAATTATCCATCATTTGTGGGG + Intronic
1145303045 17:21654008-21654030 CCAGGCATACATCAGGTGTGAGG + Intergenic
1145346994 17:22047833-22047855 CCAGGCATACATCAGGTGTGAGG - Intergenic
1146460339 17:33041124-33041146 CCCACCACCCCTCAGCTGTGTGG - Intronic
1155231059 18:23775629-23775651 AGAACCATCAATCAGGTGTGAGG + Intronic
1155358130 18:24973379-24973401 CCAACCATCCTTCATATTTGGGG - Intergenic
1163320909 19:16574121-16574143 CCTACCACCCACCAGCTGTGTGG - Intronic
1165912680 19:39238627-39238649 CCAACCTGCCATCAGTTGGGGGG + Intergenic
1168411577 19:56143493-56143515 CCACCCATCCATCAGTTTAAGGG - Intronic
926194122 2:10751626-10751648 CCAACCATCCAGTCGTTATGTGG - Intronic
928407986 2:31029528-31029550 CTAACCTTCCATTAGTTATGTGG - Intronic
930563655 2:52992662-52992684 CCAACCATCCATATGTAATGGGG + Intergenic
931110537 2:59105955-59105977 CCAACCATCAGACAGTAGTGAGG + Intergenic
932462120 2:71889217-71889239 CCAACCACCCATGTGATGTGGGG + Intergenic
941891063 2:170582456-170582478 CCAACCATACATCCCTGGTGAGG + Intronic
1170221046 20:13941823-13941845 CCACCTATCTATCATTTGTGAGG - Intronic
1177480692 21:21683183-21683205 CCAACACTCAATCAGTGGTGCGG + Intergenic
952846009 3:37688793-37688815 CCATCCATCCATCTATTCTGTGG - Intronic
953125662 3:40089344-40089366 TCAACTATCCATGAGGTGTGTGG + Intronic
953808828 3:46094801-46094823 CCAACCATCCCTGTGGTGTGAGG + Intergenic
953875420 3:46663921-46663943 GAAACCATCCAGCAGCTGTGCGG + Intergenic
954931120 3:54282404-54282426 GCAACAAACCATCAGGTGTGAGG + Intronic
955857677 3:63290902-63290924 CCAACTGTCCATCAGGTGTAAGG - Intronic
956578425 3:70781782-70781804 CCAACCATTCACGAGTTGTCTGG - Intergenic
957650031 3:82989133-82989155 CTAACAATCCCTCATTTGTGTGG - Intergenic
960940023 3:122927562-122927584 CCCACCCTCCATCTGTTCTGTGG + Intronic
968062981 3:195740064-195740086 CCAACCATCCATCAGTTGTGAGG - Intronic
972836855 4:42881426-42881448 CCATCCATCCAGAAGTTGTGAGG + Intergenic
975439760 4:74398087-74398109 CCAAGTAACCACCAGTTGTGAGG - Intergenic
979951921 4:126903551-126903573 CCATACATACATCAGTTTTGGGG + Intergenic
980705823 4:136492448-136492470 CAAACCATTCATCACGTGTGTGG - Intergenic
985509203 5:302659-302681 CCCACCCTCCAGCAGTTATGCGG - Intronic
987586106 5:19859117-19859139 GCATCCATCGGTCAGTTGTGGGG - Intronic
991270385 5:64772250-64772272 AAAACCATCCATGAGCTGTGGGG + Intronic
994018826 5:95000971-95000993 CCACCCTTCCATGATTTGTGGGG - Intronic
994111072 5:96005071-96005093 CAAACCATTAATCAGTTGTGAGG + Intergenic
1009891133 6:69684537-69684559 CAAACTATCCATTAATTGTGAGG + Intronic
1014515723 6:122376171-122376193 ACAACCATCCATCAAATGTGAGG + Intergenic
1021830376 7:24601720-24601742 CAAACCATCAATCAAGTGTGAGG - Intronic
1024643095 7:51347992-51348014 TCATCCATCCTTCAGTTGTTTGG + Intergenic
1036129823 8:6098686-6098708 CCAACCAACCACCAGATGTATGG + Intergenic
1041088569 8:54280433-54280455 GCAACCATCCATCGGTTATCAGG + Intergenic
1043282887 8:78490297-78490319 ACGAACAACCATCAGTTGTGTGG + Intergenic
1048558478 8:135506358-135506380 CCAACCTTCCATCAGATGATTGG + Intronic
1050797656 9:9564321-9564343 CCAAATTTTCATCAGTTGTGAGG + Intronic
1058658282 9:107245683-107245705 AGGCCCATCCATCAGTTGTGAGG + Intergenic
1060989075 9:127838121-127838143 TCAACCATCCTTCAGGTCTGGGG + Intronic
1187422682 X:19149859-19149881 CAAAACATCTGTCAGTTGTGTGG + Intergenic
1199044552 X:143153813-143153835 CTGACCTTCCCTCAGTTGTGAGG + Intergenic
1199656689 X:150003064-150003086 CCACCCATCCATCATCTGTGTGG + Intergenic