ID: 968064721

View in Genome Browser
Species Human (GRCh38)
Location 3:195752320-195752342
Sequence AGGGGGCGCTTGGCGGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968064721_968064725 -7 Left 968064721 3:195752320-195752342 CCTGAACCCGCCAAGCGCCCCCT 0: 1
1: 0
2: 0
3: 7
4: 105
Right 968064725 3:195752336-195752358 GCCCCCTCCCACCCAGAGCGCGG 0: 1
1: 0
2: 6
3: 46
4: 439
968064721_968064737 30 Left 968064721 3:195752320-195752342 CCTGAACCCGCCAAGCGCCCCCT 0: 1
1: 0
2: 0
3: 7
4: 105
Right 968064737 3:195752373-195752395 CGAGGCGTTGACTTCTGCCATGG 0: 1
1: 0
2: 0
3: 3
4: 51
968064721_968064734 12 Left 968064721 3:195752320-195752342 CCTGAACCCGCCAAGCGCCCCCT 0: 1
1: 0
2: 0
3: 7
4: 105
Right 968064734 3:195752355-195752377 GCGGCCTGCAGCACTGACCGAGG 0: 1
1: 0
2: 1
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968064721 Original CRISPR AGGGGGCGCTTGGCGGGTTC AGG (reversed) Intronic
900382814 1:2393285-2393307 AGGGGTCCCTTGTCTGGTTCGGG - Intronic
906032971 1:42735096-42735118 AGGGGGCCCTTGGCGGAGGCGGG + Exonic
910384368 1:86665204-86665226 AGTGGGCTCTTGGGGGTTTCTGG + Intergenic
912408902 1:109466509-109466531 AGGGGGCGGGAGGAGGGTTCGGG + Intergenic
912490191 1:110058482-110058504 AGGGGACCCATGGCGGGGTCGGG - Intronic
918127869 1:181600194-181600216 AGTGGTTGCTTGGCAGGTTCAGG + Intronic
920381422 1:205536678-205536700 AGGGGGCACTTGGTGGGGTGGGG - Intergenic
1072294440 10:93995388-93995410 AGGGGGAGGTTGGCTGTTTCAGG - Intronic
1076027905 10:127131543-127131565 AGGGGGCTCGTGGCTGGTTGGGG - Intronic
1077474149 11:2778528-2778550 AGTGGGGGCCTGGTGGGTTCGGG - Intronic
1083290731 11:61688640-61688662 AGGGGGCCCGTGGGGGGTTCTGG + Intronic
1086402290 11:86470717-86470739 AGGGGGTGCTGGGTGGATTCAGG + Intronic
1089136814 11:116255811-116255833 AGGGGAAGGTTGGCGGGGTCGGG + Intergenic
1090408344 11:126490963-126490985 AGGGGGCGTTTGGAGGGTGGAGG + Intronic
1093092015 12:14932394-14932416 AGGGGACCCTTGGCGGGTGGTGG + Intronic
1093547780 12:20368841-20368863 CGGGGGCGCAGGGCGGGCTCCGG - Intergenic
1094842333 12:34347319-34347341 AGGGGGCGCGTGGGGGGACCAGG + Intergenic
1095052318 12:37565712-37565734 AGAGAGCGCTTGGAGCGTTCCGG - Intergenic
1096388471 12:51211307-51211329 AGAGGGCCCTTGGTGGGCTCTGG - Intronic
1101884327 12:108648564-108648586 CAGGGGTGCTTGGCTGGTTCAGG - Intronic
1108200460 13:48038076-48038098 AGGGGGCGCTGTGCTGGGTCAGG + Intronic
1110626999 13:77663067-77663089 CGGGGGAGCCTGGCGGGATCTGG - Intergenic
1122546244 14:102524333-102524355 AAGGGGAGCTGGGCAGGTTCTGG + Intergenic
1123044358 14:105504089-105504111 TGGGGGCGCTGGGCCGGTTGGGG + Intergenic
1128344016 15:66842538-66842560 GCGGGGCGGGTGGCGGGTTCAGG - Intergenic
1129192602 15:73946347-73946369 AGGGGGCCCATGCTGGGTTCTGG + Intronic
1129356561 15:74995881-74995903 TGGGGGGGCTTGGGGGGCTCGGG - Intronic
1129424749 15:75455128-75455150 AGGGGGCGGTGGGCGCGCTCCGG - Intronic
1130152733 15:81323920-81323942 AGGAGGCGCTTGGGGGCTTCTGG + Intronic
1132546978 16:537711-537733 AGGGGCCGTTTGGGTGGTTCCGG + Intronic
1132875709 16:2135955-2135977 AGGGGGGGCGGGGCGGGTGCAGG + Intergenic
1133312510 16:4859239-4859261 ACGTGGCGCTTGGCCGGCTCAGG + Intronic
1134519277 16:14911398-14911420 AGGGGGGGCGGGGCGGGTGCAGG - Intronic
1134608602 16:15590259-15590281 AGGGGGGGCTTGGGGGGTCCGGG + Intronic
1134706947 16:16310053-16310075 AGGGGGGGCGGGGCGGGTGCAGG - Intergenic
1134960593 16:18402071-18402093 AGGGGGGGCGGGGCGGGTGCAGG + Intergenic
1142335823 16:89489666-89489688 AGGGGGCGCTGGCCGGGCGCCGG - Intronic
1142903834 17:3029436-3029458 AGGGTGGGCTTGGGGGGATCTGG + Intronic
1148052314 17:44775340-44775362 AGCGGGCCCTGGGCGGGGTCCGG + Intronic
1152290960 17:79440052-79440074 AGAGGGCACTTGGGGGGATCTGG + Intronic
1154382712 18:13867097-13867119 AGAGGGCTCTTGGTGTGTTCTGG - Intergenic
1160517614 18:79487158-79487180 GTGGGGCCCTTGGCGGGTCCTGG + Intronic
1161189578 19:2945493-2945515 AGGGAGCGCCTGGTGGGGTCCGG - Intergenic
1161253980 19:3295991-3296013 AAGGGGTGCTTGGCCGGTCCGGG - Intronic
1164996085 19:32720816-32720838 TGGGGGCGCAGGGAGGGTTCAGG - Intronic
1168648968 19:58080683-58080705 AGGGGCAGCTGGGCTGGTTCAGG - Intronic
928381718 2:30823850-30823872 AGGAGGGGCTTGACGGGTCCTGG + Intergenic
932063562 2:68529904-68529926 CGGGGGAGCCTGGCGGGATCTGG - Intronic
932753865 2:74391658-74391680 GGTGGGCGCTTGTCGGGGTCCGG - Intronic
933691232 2:85181046-85181068 AGGGGGAGGCTGGTGGGTTCAGG + Intronic
937363879 2:121247022-121247044 AGGGGGCGCTTGGGGGATCCAGG - Intronic
947918043 2:233847343-233847365 AGGGGGCGCTTGGGGGCTCAGGG - Intronic
947953179 2:234165368-234165390 AGGGGGGGCTTGGGGGGTGGGGG - Intergenic
948975638 2:241461833-241461855 GGGTGGCTCTTGGAGGGTTCAGG + Intronic
1173896100 20:46551928-46551950 AGGGGGAGCCTGGGGGGCTCAGG - Intergenic
1174868799 20:54164404-54164426 CGGGGGTGCTGGGCTGGTTCTGG + Intronic
1180109564 21:45641858-45641880 TGGACGCGCTTGGCGGTTTCGGG - Intergenic
1180177679 21:46098305-46098327 GCGGGGGGCTCGGCGGGTTCGGG + Intronic
1180787157 22:18553505-18553527 AGGGGGTGCATGGCTGGTCCAGG + Intergenic
1181234583 22:21441801-21441823 AGGGGGTGCATGGCTGGTCCAGG - Intronic
1181244066 22:21493030-21493052 AGGGGGTGCATGGCTGGTCCAGG + Intergenic
1185065806 22:48631185-48631207 AGGGGGCCCTTGGTGTGCTCCGG + Intronic
954279855 3:49569588-49569610 GGGGGACGCTTGGAGGGCTCAGG + Intronic
964876227 3:161371872-161371894 AGGGGGCGCTTTCCCGGTGCAGG + Exonic
966862519 3:184238510-184238532 AGTGGGCGCTGGGAGGGGTCAGG + Intronic
966911383 3:184562137-184562159 AGGGTGCGCTCGGCGGGCTCCGG - Exonic
968064721 3:195752320-195752342 AGGGGGCGCTTGGCGGGTTCAGG - Intronic
968556359 4:1248233-1248255 TGGGGGCGCTGGGCCGGTCCGGG + Intronic
968958493 4:3730731-3730753 AGGGGGCGCAGGGCAGGTGCTGG + Intergenic
969299750 4:6290964-6290986 AGGGGGCACTTGGGGGCGTCTGG + Intronic
971377870 4:26069580-26069602 AGGGGGCTCTTGACTGGGTCTGG - Intergenic
983453995 4:167940109-167940131 AGGGAGCTCTTGGCGGGGTGTGG - Intergenic
984925555 4:184803343-184803365 AGAGGTCGCATGGCGGCTTCAGG + Exonic
985512477 5:320614-320636 AGGAGGCGCGGGGCGGGTTGGGG + Intronic
985515756 5:343844-343866 AGGGCGCACGTGGCGCGTTCCGG + Intronic
985574362 5:666621-666643 CGGGGCCGCCTGGCGGGTTTTGG - Intronic
985815790 5:2126731-2126753 AGAAGGCGCTAGGTGGGTTCTGG + Intergenic
998138507 5:139687144-139687166 AGGGGGCGCCTGGCAGGCGCTGG - Intergenic
998200001 5:140112115-140112137 AAGGGGGGCTTTGAGGGTTCAGG + Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998335082 5:141364558-141364580 AGCTGCCGCTTCGCGGGTTCAGG - Exonic
998461798 5:142315078-142315100 AGGGGGCGCTCTGTGGGATCGGG + Exonic
1001395988 5:171419916-171419938 AGGAGGCGCCTGGCCGGTGCGGG - Exonic
1005242987 6:23853749-23853771 CGGGGGAGCCTGGCGGGATCTGG + Intergenic
1009398854 6:63230777-63230799 AGGGGGAGCCTGGCGGGATCTGG - Intergenic
1013900946 6:115155828-115155850 ATGGGGCTCTGGGCTGGTTCTGG + Intergenic
1018669429 6:166167128-166167150 AGGGCGCGCCTCGCGGGTCCCGG + Intronic
1022219341 7:28297099-28297121 AGGGGGCGCCTGGGGGCCTCAGG + Intergenic
1024482857 7:49883210-49883232 AGGTTCCGCTTGGCAGGTTCGGG - Intronic
1026085003 7:67255631-67255653 AGAGGGAGTTTGGCGGGTCCAGG + Intergenic
1029207714 7:98879126-98879148 AGGCCGGGCTTGGCGGGGTCTGG + Intronic
1029570332 7:101364073-101364095 AGGAGACGCCTGGCGGGTCCCGG - Intronic
1040284343 8:46092311-46092333 AGGGGGCGCTCTGGGGGTTCTGG - Intergenic
1040319879 8:46287102-46287124 AGGGGGCGCTGGAGGGCTTCTGG + Intergenic
1040386095 8:46916034-46916056 AGGGGGCGCTTTGTGGGGTGGGG + Intergenic
1041573543 8:59366397-59366419 AGGGGGCACTTGGCCAGGTCAGG + Intergenic
1049551808 8:143263503-143263525 AGGGAGAGCTGGGAGGGTTCTGG - Intronic
1049659925 8:143815400-143815422 CGGCGGCGCTCGGCGGGCTCGGG + Intergenic
1049845431 8:144798728-144798750 GGGGCGCGCCTGGGGGGTTCCGG - Intergenic
1052413099 9:28147523-28147545 CGGGGGAGCCTGGCGGGATCTGG + Intronic
1053557218 9:39149841-39149863 AGGGGGCGCTGGGGAGTTTCAGG - Exonic
1053797952 9:41742950-41742972 AGAGAGCGCTTGGAGCGTTCCGG + Intergenic
1053821326 9:41970109-41970131 AGGGGGCGCTGGGGAGTTTCAGG - Exonic
1054090203 9:60838261-60838283 AGGGGGCGCTGGGGAGTTTCAGG - Intergenic
1054111614 9:61113818-61113840 AGGGGGCGCTGGGGAGTTTCAGG - Intergenic
1054186366 9:61955005-61955027 AGAGAGCGCTTGGAGCGTTCCGG + Intergenic
1054609243 9:67217307-67217329 AGGGGGCGCTGGGGAGTTTCAGG + Intergenic
1054652139 9:67633518-67633540 AGAGAGCGCTTGGAGCGTTCCGG - Intergenic
1056794361 9:89647437-89647459 TGGGGACGCTTGGCTGGGTCTGG - Intergenic
1057613505 9:96567420-96567442 CGGGGGCACTTGGCGGGTCTTGG - Intronic
1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG + Intergenic
1062207937 9:135347424-135347446 AGGGTGTGCTTGCCGGGTGCTGG - Intergenic
1187071807 X:15895975-15895997 ATGGGGCGGTTGCCGGGGTCGGG - Intergenic