ID: 968065104

View in Genome Browser
Species Human (GRCh38)
Location 3:195754139-195754161
Sequence TCAAGGGTGTAGACAGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968065104_968065111 23 Left 968065104 3:195754139-195754161 CCTTTGGCTGTCTACACCCTTGA 0: 1
1: 0
2: 0
3: 3
4: 120
Right 968065111 3:195754185-195754207 CCTGCTCCAGGCCCTGTTCCCGG 0: 1
1: 1
2: 5
3: 90
4: 722
968065104_968065107 11 Left 968065104 3:195754139-195754161 CCTTTGGCTGTCTACACCCTTGA 0: 1
1: 0
2: 0
3: 3
4: 120
Right 968065107 3:195754173-195754195 CTCCCAGAAGCGCCTGCTCCAGG 0: 1
1: 0
2: 2
3: 32
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968065104 Original CRISPR TCAAGGGTGTAGACAGCCAA AGG (reversed) Intronic
900870414 1:5298198-5298220 TCAAGGGAACAGACAGCCAGAGG - Intergenic
902772286 1:18652201-18652223 TTAAGGGTGGAGGCAGCCAGTGG - Intronic
903046081 1:20565319-20565341 TCAAGGGAGTTAACAGCAAAAGG + Intergenic
903622484 1:24707873-24707895 TCAAGGGAGTTGACAGCTGAAGG + Intergenic
905281054 1:36849712-36849734 TCAAAGGTGCAGAGAGCCCATGG + Intronic
906526461 1:46496093-46496115 TCAAAGGTGCAGAAAGCCCAGGG - Intergenic
907475201 1:54700902-54700924 GGAAGGGGGTAGACAGCAAAGGG + Intronic
911473969 1:98353629-98353651 GGAAAGGTGTAGTCAGCCAAAGG - Intergenic
913711436 1:121487907-121487929 TCAAGCGTGTAGTAAGCCATGGG - Intergenic
917728130 1:177847147-177847169 TCAAGGGGGAAGACAGGCAGGGG - Intergenic
918540168 1:185623565-185623587 TCAAGGATGTGGACACACAATGG + Intergenic
1066295799 10:34053501-34053523 GCAAGGGTGTGGATAGCAAAAGG - Intergenic
1069632069 10:69903073-69903095 TCCAGGGAGGAGACCGCCAATGG + Intronic
1070659915 10:78298038-78298060 TCAAGGGTAAAGATAGTCAATGG - Intergenic
1071491803 10:86141230-86141252 CCAAGGGTGTTGACAGCCTGGGG - Intronic
1079489792 11:20974783-20974805 TCTGGGGTATAGACAGTCAAAGG + Intronic
1080766705 11:35304012-35304034 TCAAGGCTCTGGAAAGCCAAGGG - Intronic
1081375976 11:42359077-42359099 TCAAAGTTTTAGCCAGCCAAGGG + Intergenic
1084595711 11:70115808-70115830 TCATGGGTCTAGACTGCCTATGG - Intronic
1085203041 11:74713257-74713279 TCAGAGGTGTAGACACACAAAGG - Intronic
1087051575 11:93890852-93890874 TCAAGGATGTGGACACACAAAGG - Intergenic
1087444582 11:98233924-98233946 GCAAAGGTGTAGGGAGCCAAGGG + Intergenic
1089781267 11:120874810-120874832 TGAATGCTGTGGACAGCCAAGGG + Intronic
1090529393 11:127574936-127574958 TCTAGGGTGTTCACAGCAAAAGG + Intergenic
1092532170 12:9353655-9353677 TCAAGGGTGTAGGCAGTGGAAGG + Intergenic
1093414776 12:18907558-18907580 TAAAGTGAGTAGACAACCAATGG - Intergenic
1100225241 12:92549828-92549850 GAAAAGATGTAGACAGCCAATGG + Intergenic
1103453452 12:121046142-121046164 TCAAGGGAGTTAACACCCAATGG - Intergenic
1105166435 13:17518764-17518786 TGATGTGTGTACACAGCCAAAGG + Intergenic
1105178115 13:17700986-17701008 TGATGGGTGTACCCAGCCAAAGG + Intergenic
1106519581 13:30484913-30484935 CCAAGGGGATAAACAGCCAAAGG + Intronic
1107263192 13:38519676-38519698 TCAAGGATGCAGACACACAAAGG - Intergenic
1108176958 13:47801928-47801950 ACAAGGGTGTGGACACCAAAAGG + Intergenic
1112573744 13:100617199-100617221 TCAAGGCTGTAGTGAGCCACTGG - Intronic
1113856099 13:113446199-113446221 TCTAGGGGGTTCACAGCCAAGGG - Intronic
1116360051 14:43982818-43982840 TCCAGGGTGGACACAGCAAAGGG + Intergenic
1116852576 14:49923485-49923507 TCAGGGCTGTAGTCATCCAAAGG + Intergenic
1117025750 14:51618323-51618345 ACTAGAGTGTAGAGAGCCAAGGG + Intronic
1119544646 14:75462799-75462821 TCATGGGTGTAGACAGCATGGGG + Intronic
1121232921 14:92371697-92371719 TCAAGGATGTGGACACACAACGG - Intronic
1121249807 14:92490921-92490943 GCAAAGATGAAGACAGCCAAGGG - Intronic
1122734845 14:103832162-103832184 TCAATGATGTAGACAGCAACTGG - Intronic
1128497801 15:68208159-68208181 TGAAGGGTGTAGAAAGCCCAGGG + Exonic
1128789541 15:70423024-70423046 TCAGAGGGGCAGACAGCCAAGGG + Intergenic
1131728914 15:95258146-95258168 TCAAGGGTATAGATAGCCCTAGG - Intergenic
1133729659 16:8568830-8568852 TCAAGGATGTAGACAGCAGCAGG + Intergenic
1137878614 16:52022271-52022293 TCACAGGTGGAGACAGACAAAGG - Intronic
1141304134 16:82845167-82845189 TCACTGCTGTAGACAGCCAGGGG + Intronic
1142643038 17:1295679-1295701 TCAAGGGTGTACCCAGCCTCAGG + Intronic
1143334662 17:6163221-6163243 GCAAGGGTGCAGAGAGCCAGTGG + Intergenic
1146701504 17:34964640-34964662 TCAAGGAGGAAGACTGCCAAAGG - Intronic
1148210008 17:45802750-45802772 TCAGGGTTCTAGGCAGCCAAGGG + Intronic
1151131133 17:71897191-71897213 ACAAGGATGTAGAAAGCCCAAGG - Intergenic
1153874915 18:9361397-9361419 ACAAAGGAATAGACAGCCAAGGG - Intronic
1155472446 18:26205102-26205124 TGAAGTGTATATACAGCCAACGG + Intergenic
1157212241 18:45753563-45753585 TCAAGGCTGTAGAGTGCCACTGG + Intergenic
1158772441 18:60535844-60535866 TCAGGGGTGTTGATAGCCACAGG + Intergenic
1159484148 18:69031750-69031772 TCACCTGTGTAGACAGCCGATGG + Intronic
1160326994 18:77959026-77959048 TAAAGGATAGAGACAGCCAAAGG + Intergenic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1162747837 19:12809017-12809039 TAACTGGTGTAGACAGACAAGGG + Intronic
927587143 2:24318210-24318232 TCAAGGCTGCAGTGAGCCAAGGG - Intronic
929960993 2:46496307-46496329 GCATGGGTGGAGACAGCCACTGG - Intronic
935800630 2:106691611-106691633 GCAGGGGTGTAGACAGAAAAAGG + Intergenic
939119697 2:138101512-138101534 TCAAGGGAAATGACAGCCAAGGG - Intergenic
941993891 2:171583113-171583135 TGAAGGGTGCAGTGAGCCAAGGG + Intergenic
941993894 2:171583129-171583151 CCAAGGGTGCAGTGAGCCAAGGG + Intergenic
943246264 2:185455473-185455495 TAGAGAGAGTAGACAGCCAAGGG - Intergenic
944348605 2:198700331-198700353 TCTAGGGTAAAGAAAGCCAAAGG - Intergenic
945555350 2:211268835-211268857 TCATGGTTGTACACAGCCCATGG + Intergenic
946287138 2:218712305-218712327 TCAGGGTTGTAGACTTCCAAGGG + Intronic
946827727 2:223695850-223695872 TCAAAGGGGTAGTCTGCCAATGG + Intergenic
947407519 2:229795149-229795171 GCAAGGGTATAGCCAGGCAATGG + Intronic
948482879 2:238261525-238261547 GCAAGGCTGGAGAGAGCCAAGGG + Intronic
948798462 2:240419215-240419237 TCAGGGATGAAGTCAGCCAAAGG - Intergenic
1169228507 20:3871212-3871234 TGAAGGGTTGAGAAAGCCAAGGG + Exonic
1172297754 20:33825529-33825551 TCAAGTGTGAAGACAGCTCATGG - Intronic
1172880601 20:38197373-38197395 CCAAGGGTATACAAAGCCAAGGG + Intergenic
1181626088 22:24123169-24123191 TCAATGGTGCAGACAGCCCAAGG - Intronic
954654297 3:52184631-52184653 TCAGGGGTGTACAGAGCCATCGG + Intergenic
956603805 3:71051416-71051438 TCAAGGGAGGAGGCAGCAAAGGG + Intronic
960872094 3:122260353-122260375 GCAAGGGTGTGGACTACCAAGGG - Intronic
961388463 3:126537703-126537725 TCCAGGGAGTTGACACCCAACGG - Intronic
968065104 3:195754139-195754161 TCAAGGGTGTAGACAGCCAAAGG - Intronic
971387896 4:26158217-26158239 TCAAGGGTGGAGACTGTCTAAGG + Intergenic
971616992 4:28803729-28803751 TCAAGGGGGAAGAAAGGCAAGGG - Intergenic
976155772 4:82143233-82143255 TCAAATCTGTAGGCAGCCAAAGG - Intergenic
980705694 4:136490264-136490286 TCCAGGATGTAGACAGGGAAGGG + Intergenic
983442759 4:167808354-167808376 TCAAGGGTGACTCCAGCCAACGG + Intergenic
988098641 5:26650215-26650237 TCAAGGGAGAAGACACTCAAGGG - Intergenic
988565982 5:32320417-32320439 TCAAGAGTGTGCACACCCAACGG + Intergenic
995190134 5:109310971-109310993 TGAACTGTGTAGACAGACAATGG + Intergenic
997096583 5:130920011-130920033 AAAAGAGTGTAGACAGGCAATGG + Intergenic
998398862 5:141837190-141837212 TCAGGGGTGGAGACAGCAAATGG - Intergenic
998455597 5:142270162-142270184 TCAGGTGTGGAGAAAGCCAAGGG - Intergenic
1001936650 5:175710213-175710235 TCTAGGGGTTAGACAGACAACGG - Intergenic
1002649224 5:180679503-180679525 TCAAGGGTGAAGACAGAAAGAGG - Intergenic
1003221339 6:4163619-4163641 TCAAGGCTGCTGACAACCAAGGG - Intergenic
1003533908 6:6959370-6959392 TCATCGATGTAGACAGCCCAGGG + Intergenic
1005603800 6:27454880-27454902 TCGAGGGTGTTGACAACCAGGGG + Intronic
1009372003 6:62916821-62916843 TCAACAGAGTAAACAGCCAATGG + Intergenic
1015365360 6:132391763-132391785 TCAAGGCTTTAGGCAACCAATGG - Intronic
1018008000 6:159641269-159641291 TCAAGGATGCAGACACACAAAGG - Intergenic
1018996397 6:168713696-168713718 CCAATGGTGTGGACAGCCAGAGG - Intergenic
1023622767 7:42089600-42089622 GGAAGGGTGTACCCAGCCAAGGG - Intronic
1023870107 7:44258753-44258775 TCAAGGGAGTGGCCAGCCCACGG + Intronic
1025208280 7:57005821-57005843 GCATGTGTGTAGACAGCCACAGG - Intergenic
1025663671 7:63571057-63571079 GCATGTGTGTAGACAGCCACAGG + Intergenic
1026853261 7:73737776-73737798 TTCTGGGGGTAGACAGCCAAAGG + Intronic
1029839200 7:103344467-103344489 TCAAGGGTAGAGAGAGCCCAGGG + Intronic
1030718173 7:112835628-112835650 TTAAGGGTGGAGACAGAGAAGGG - Intronic
1031799994 7:126230881-126230903 TGATGGGTGTATAGAGCCAAGGG + Intergenic
1035357252 7:158283636-158283658 TCAACGGTGTTGGCCGCCAATGG + Intronic
1036543375 8:9741239-9741261 TTAAGGGTTTATAAAGCCAATGG + Intronic
1037054988 8:14429126-14429148 ACAAGGATGTAGACTGCAAAGGG - Intronic
1037571710 8:20163558-20163580 TCAAAGGTGTTGGGAGCCAAAGG - Intronic
1046958255 8:120083571-120083593 TGAAGGCTGAAGAAAGCCAATGG - Intronic
1050406649 9:5315422-5315444 AAAAGTGTGAAGACAGCCAATGG + Intergenic
1051415609 9:16836866-16836888 TCAATGCTGTGGACAGCCCAAGG - Intronic
1052333852 9:27299760-27299782 TCAAAGCTTTAGTCAGCCAAAGG + Intergenic
1060893384 9:127202512-127202534 ACAAGGGTGCAGAGAGCAAAGGG + Intronic
1061151163 9:128829138-128829160 TCCAGGGTGAACACGGCCAAAGG - Exonic
1188343963 X:29041142-29041164 TCAAGGGTGCAGACATTCACTGG - Intronic
1194041316 X:88945150-88945172 TCAAGGATGTGGACACACAAAGG - Intergenic