ID: 968065638

View in Genome Browser
Species Human (GRCh38)
Location 3:195757528-195757550
Sequence TCCAACATACTGATTGTAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968065634_968065638 2 Left 968065634 3:195757503-195757525 CCCAGCTGGAAGGACGTGGCACC 0: 1
1: 0
2: 2
3: 56
4: 1263
Right 968065638 3:195757528-195757550 TCCAACATACTGATTGTAGCGGG 0: 1
1: 0
2: 0
3: 4
4: 92
968065635_968065638 1 Left 968065635 3:195757504-195757526 CCAGCTGGAAGGACGTGGCACCA 0: 1
1: 0
2: 0
3: 14
4: 217
Right 968065638 3:195757528-195757550 TCCAACATACTGATTGTAGCGGG 0: 1
1: 0
2: 0
3: 4
4: 92
968065631_968065638 14 Left 968065631 3:195757491-195757513 CCTGGTCACGCTCCCAGCTGGAA 0: 1
1: 0
2: 0
3: 11
4: 103
Right 968065638 3:195757528-195757550 TCCAACATACTGATTGTAGCGGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968065638 Original CRISPR TCCAACATACTGATTGTAGC GGG Intronic
901159022 1:7160881-7160903 ACCAACTGACTGATTGGAGCAGG - Intronic
908666197 1:66493868-66493890 TCCAACATACTGATTCCATTTGG + Intergenic
910579364 1:88805721-88805743 TCTTACGTACTGATTATAGCAGG + Intronic
911812273 1:102297579-102297601 TCTAATATTCTGATTGTTGCTGG + Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923724751 1:236496327-236496349 TTCTACATACAGATTGAAGCTGG - Intergenic
924412958 1:243825722-243825744 TCCAAATTCCTGTTTGTAGCCGG - Intronic
1070972796 10:80581392-80581414 TTCAAAATACGGATTTTAGCAGG - Intronic
1077277663 11:1722193-1722215 TCCAACATACAGATTATAAGTGG - Intergenic
1082208817 11:49472074-49472096 TTCAACATACTAATTTTAGGGGG - Intergenic
1084211987 11:67628669-67628691 TCCACCAAACTGAGTGGAGCTGG + Intronic
1086640799 11:89153133-89153155 TTCAACATACTAATTTTAGGGGG + Intergenic
1086816092 11:91373082-91373104 CCCTTCATAATGATTGTAGCAGG - Intergenic
1088901733 11:114123206-114123228 TTCAACATATTAATTGTAGAGGG + Intronic
1101734225 12:107450913-107450935 TTCAACATACTCATTATAGTAGG + Intronic
1109068563 13:57733978-57734000 TACAAAATACAGATTGTAGTTGG + Intergenic
1110326232 13:74218738-74218760 TCTAACATAATGATGTTAGCTGG + Intergenic
1112969593 13:105244106-105244128 TCCAACATACAGATTTGAGATGG - Intergenic
1123140828 14:106076398-106076420 TCCAGCAAAATGATTGGAGCTGG + Intergenic
1124718694 15:32093141-32093163 TCCGGCATACTGAGTGGAGCAGG - Intronic
1125118718 15:36126481-36126503 TCCAATATACTGGTTTTAGGAGG - Intergenic
1126548254 15:49896883-49896905 TCCAACACACTAAATGTATCTGG - Intronic
1130050165 15:80477780-80477802 TTTAACATACTAATTTTAGCGGG + Intronic
1131668121 15:94591589-94591611 TCCAAGGTACTCACTGTAGCTGG + Intergenic
1133852888 16:9522884-9522906 TCCAACACACTGCATGTAGCAGG + Intergenic
1134867027 16:17617577-17617599 TCCAAAACACTGGTTGTAGTCGG - Intergenic
1139595212 16:67953903-67953925 TCCCACATAATGAATGTAGAAGG + Intronic
1141507567 16:84488211-84488233 TAAAACATACTGATTCTAGATGG + Intronic
1146820682 17:35981817-35981839 CCCAACATACAGATGGTGGCAGG - Intergenic
1151212563 17:72555399-72555421 TTCAACATACTCATTGTTACAGG + Intergenic
1153276952 18:3376809-3376831 TTCAAAATAATAATTGTAGCAGG - Intergenic
1153486253 18:5601645-5601667 TCCAAGAAACTGGTTGTATCAGG + Intronic
1159053426 18:63442863-63442885 CCCAAATTACTGAATGTAGCTGG - Intergenic
1166172623 19:41042151-41042173 TTCAACATACTGATTTTGTCAGG - Intergenic
925572812 2:5330123-5330145 CCCAGCATCCTGATTGGAGCAGG + Intergenic
927447744 2:23180024-23180046 TTCAAGATCCTGATTTTAGCTGG - Intergenic
936875663 2:117186153-117186175 TCCAAGACACTGACTTTAGCAGG + Intergenic
937490836 2:122365637-122365659 ACAAACATTCAGATTGTAGCAGG + Intergenic
948519711 2:238528160-238528182 CCCAACAGACTAAATGTAGCAGG + Intergenic
1183486608 22:38090470-38090492 TGCAGCATTCTGATTGTACCTGG - Intronic
949448441 3:4161332-4161354 TCCCACCTGCTGATTGTAGAGGG - Intronic
951868281 3:27331995-27332017 TCCAAGGTACTCATTCTAGCTGG - Intronic
952108982 3:30100581-30100603 TCTAACACACTGGTTATAGCAGG + Intergenic
952993210 3:38851170-38851192 TCCAACATACTTATGTGAGCAGG - Intronic
958142533 3:89580424-89580446 TACAACATACTGATAGTAATTGG - Intergenic
960394672 3:117121554-117121576 TCCAGCATACGGAATGAAGCTGG + Intronic
961993675 3:131218566-131218588 TCCAACATATGGCTTTTAGCGGG - Intronic
962619291 3:137161108-137161130 TCTGACATACTTATTGTACCTGG - Intergenic
963264396 3:143226474-143226496 TCCAAAATCCTGATTTTACCTGG + Intergenic
963328123 3:143884559-143884581 TCCAAAATATTGATAGTATCAGG - Intergenic
966037000 3:175430538-175430560 CCCATCCTACTGATTTTAGCTGG - Intronic
966564119 3:181357272-181357294 TCCAACTCTCTAATTGTAGCTGG - Intergenic
968065638 3:195757528-195757550 TCCAACATACTGATTGTAGCGGG + Intronic
969633076 4:8349766-8349788 TTCAACATACAAATTGTAGGGGG + Intergenic
971910780 4:32794113-32794135 TCCATCATTCTGATTGATGCGGG + Intergenic
976885733 4:89981342-89981364 TCCAAGATCATGATGGTAGCAGG - Intergenic
983506333 4:168557519-168557541 TCCAACATATTGATTATGCCTGG - Intronic
985227718 4:187780675-187780697 TTCAAAATACTGATTATACCAGG + Intergenic
988354561 5:30156497-30156519 TCCAAAATAGTGATTGCATCTGG + Intergenic
989035619 5:37168632-37168654 TTTAAAATAATGATTGTAGCTGG - Intronic
990399347 5:55422397-55422419 TGCAACAGACTGTTTTTAGCAGG - Intronic
990711804 5:58590033-58590055 GCCAACACATTGATTTTAGCTGG + Intronic
993654716 5:90563362-90563384 TCCAGCATAGTTATTGTTGCTGG + Intronic
995026016 5:107423536-107423558 TCAAAAATACTCATTTTAGCTGG - Intronic
999692867 5:154163835-154163857 TCCCACATACCCATTTTAGCAGG - Intronic
1000725595 5:164766082-164766104 TCCAACATATTAATTTTAGAAGG + Intergenic
1003934806 6:10964351-10964373 TCCATCATAGTGATTGATGCAGG - Intronic
1005468323 6:26137070-26137092 TCCAACAAACTTATCCTAGCAGG - Intronic
1008069650 6:47086437-47086459 TCCAAAATACTGGTAGTGGCTGG + Intergenic
1016166723 6:140954396-140954418 CTCAACACAGTGATTGTAGCAGG - Intergenic
1022965547 7:35468134-35468156 TCCAAAGTACTGATGGCAGCAGG + Intergenic
1026289454 7:68993059-68993081 TCCAAAATGTTAATTGTAGCGGG + Intergenic
1028954022 7:96668701-96668723 TCCAATTTCCTGATTGTAACTGG + Intronic
1028971614 7:96865179-96865201 GCCAACATACTGATTTTATTTGG - Intergenic
1034842885 7:154415917-154415939 TCCAACACAAGGGTTGTAGCAGG - Intronic
1037423759 8:18732246-18732268 AACAAAATACTGATTGTAGATGG + Intronic
1038155390 8:24984470-24984492 TATAACATACTGATTATAGCTGG - Intergenic
1039186680 8:34925111-34925133 CCCTACATACTGATTGCTGCTGG + Intergenic
1040346245 8:46499858-46499880 TCCAACCTGCTGAATGTAGAGGG + Intergenic
1041261123 8:56021213-56021235 TCCACCATCCTGTTTGAAGCTGG - Intergenic
1044990851 8:97794443-97794465 CCCAACATTCTGATTGAAACTGG - Intronic
1045140111 8:99270837-99270859 TCTAACATAGTGATTGGAACAGG + Intronic
1048662610 8:136622592-136622614 TCCCACATGCTCATTGTGGCTGG + Intergenic
1050179183 9:2901360-2901382 TCAAACATACTGAATATAGTGGG - Intergenic
1052363678 9:27587946-27587968 TCATAAATACTAATTGTAGCTGG + Intergenic
1052962487 9:34311920-34311942 TCCCAACAACTGATTGTAGCAGG + Intronic
1057627544 9:96691337-96691359 TCTAACATACTGATTGGATCAGG - Intergenic
1057777515 9:98022805-98022827 TTCAACATACGGATTTTAGGGGG + Intergenic
1059932413 9:119274037-119274059 ACAAAGATACAGATTGTAGCAGG + Intronic
1186368555 X:8922164-8922186 TCCAACAAACCCTTTGTAGCAGG + Intergenic
1188581412 X:31718458-31718480 TTCAACATACAAATTTTAGCCGG - Intronic
1193164079 X:78262067-78262089 TCCATCATAATGGTTCTAGCTGG + Intergenic
1197655295 X:129110367-129110389 TCCAAAGTATTGATTATAGCAGG + Intergenic
1198748425 X:139914240-139914262 TCCAACATCTTCATTATAGCTGG - Intronic
1199619123 X:149683533-149683555 TGAAACCTACTGATTGTAGCTGG - Intergenic
1199687996 X:150281370-150281392 CCCAACTTAGTGAGTGTAGCAGG - Intergenic
1200876209 Y:8157309-8157331 TCCTACATACTAAATGTAACTGG - Intergenic