ID: 968065918

View in Genome Browser
Species Human (GRCh38)
Location 3:195759405-195759427
Sequence GCTCTCGACTGACGCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968065916_968065918 8 Left 968065916 3:195759374-195759396 CCTCTGGAAGAAGGAATTATTCT 0: 1
1: 0
2: 3
3: 19
4: 303
Right 968065918 3:195759405-195759427 GCTCTCGACTGACGCACAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 61
968065910_968065918 25 Left 968065910 3:195759357-195759379 CCCAGGACTGTGACCCACCTCTG 0: 1
1: 0
2: 3
3: 27
4: 295
Right 968065918 3:195759405-195759427 GCTCTCGACTGACGCACAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 61
968065914_968065918 12 Left 968065914 3:195759370-195759392 CCCACCTCTGGAAGAAGGAATTA 0: 1
1: 0
2: 3
3: 22
4: 244
Right 968065918 3:195759405-195759427 GCTCTCGACTGACGCACAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 61
968065915_968065918 11 Left 968065915 3:195759371-195759393 CCACCTCTGGAAGAAGGAATTAT 0: 1
1: 0
2: 2
3: 29
4: 265
Right 968065918 3:195759405-195759427 GCTCTCGACTGACGCACAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 61
968065911_968065918 24 Left 968065911 3:195759358-195759380 CCAGGACTGTGACCCACCTCTGG 0: 1
1: 0
2: 4
3: 21
4: 244
Right 968065918 3:195759405-195759427 GCTCTCGACTGACGCACAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968065918 Original CRISPR GCTCTCGACTGACGCACAGC AGG Intronic
902727514 1:18347002-18347024 TCTCTCAACTGGCGCTCAGCCGG - Intronic
904213699 1:28902949-28902971 GTTCTGGACTCACACACAGCTGG + Intronic
906906074 1:49893689-49893711 GCTCTCTACTGAGGCTGAGCTGG - Intronic
908683877 1:66692459-66692481 GCTGTCAGCTGACCCACAGCAGG - Intronic
909343796 1:74561677-74561699 GCTCTCTACTTAGACACAGCAGG + Intergenic
914746558 1:150505640-150505662 ACTCTGGACTGACCCTCAGCCGG + Exonic
924308190 1:242713456-242713478 GCCTTGGACTGACTCACAGCTGG - Intergenic
1068955182 10:62815001-62815023 GCCCTCGGCTGAAGCGCAGCGGG - Intronic
1076345209 10:129774711-129774733 GCTCTCCACTCCTGCACAGCTGG - Intergenic
1092477065 12:8828503-8828525 GCTCTCCTCTGACAAACAGCAGG + Intronic
1095412978 12:41944944-41944966 GCTCTCATCTGAGGCACAACTGG + Intergenic
1095882574 12:47153872-47153894 GCTCTAGCCTGGAGCACAGCAGG - Intronic
1101730929 12:107426328-107426350 GCTCTGCACTGACTCACAGCAGG - Intronic
1104784799 12:131442706-131442728 ACTCTGGTCTGCCGCACAGCGGG + Intergenic
1106574388 13:30961211-30961233 GCTCTGGACTGAGGGACACCAGG - Intronic
1108686957 13:52827974-52827996 GCCCTGGGCTGAGGCACAGCTGG + Intergenic
1109567089 13:64131717-64131739 GCTCTCCTCTGGAGCACAGCAGG - Intergenic
1112746933 13:102536991-102537013 GGGCTCAACTGAGGCACAGCAGG + Intergenic
1114063110 14:19037953-19037975 GCACTGGACTGGGGCACAGCAGG - Intergenic
1114099148 14:19362042-19362064 GCACTGGACTGGGGCACAGCAGG + Intergenic
1119419080 14:74495751-74495773 GCTCTGGTCTCATGCACAGCAGG + Exonic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1124025057 15:25958376-25958398 GCTCCTGACTGACCCACAGGAGG + Intergenic
1124167777 15:27343267-27343289 GCTCATGACTGAGGCACTGCAGG - Intronic
1129756689 15:78103156-78103178 GGTCTCCCCTGACCCACAGCTGG - Intronic
1133286040 16:4691321-4691343 TGCCTCCACTGACGCACAGCAGG - Intergenic
1136235487 16:28911137-28911159 GCTCGCGACTGACGCTCTCCAGG + Exonic
1152279834 17:79378853-79378875 GCTCTCCACAGCCGCACAGTGGG + Intronic
1154450989 18:14474768-14474790 GCACTGGACTGAGGCACAGCAGG + Intergenic
1154451232 18:14475799-14475821 GCCCTGGACTGTGGCACAGCAGG + Intergenic
1165363866 19:35352183-35352205 GCTCCGGCCTGACGCACAGGCGG + Exonic
1165612628 19:37169618-37169640 CCTCTCCACTGTCGCACAGATGG + Intronic
926133846 2:10322957-10322979 GCTCTTGACAGACAGACAGCAGG + Intronic
926231589 2:11008258-11008280 GCTCTCGAATGTTCCACAGCAGG - Intergenic
926329168 2:11810630-11810652 GCTCTCAACTGACGGACATATGG + Intronic
926720231 2:15954666-15954688 GCTCTGGTCTCCCGCACAGCTGG + Intergenic
928106275 2:28472435-28472457 GCTCTGGAATGATGCTCAGCAGG + Intronic
930839304 2:55827441-55827463 GCTCTGGTCTCCCGCACAGCCGG - Intergenic
938480464 2:131658115-131658137 GCACTGGACTGAGGCACAGCAGG - Intergenic
947162242 2:227226316-227226338 GCTCTGGACAGAAGCACAGTGGG + Intronic
1170441610 20:16385291-16385313 GCTCTCTCCTGACACTCAGCAGG + Intronic
1176444910 21:6814436-6814458 GCCCTGGACTGTGGCACAGCAGG - Intergenic
1176445248 21:6815805-6815827 GCACTGGACTGAGGCACAGCAGG - Intergenic
1176823075 21:13679469-13679491 GCCCTGGACTGTGGCACAGCAGG - Intergenic
1176823415 21:13680838-13680860 GCACTGGACTGAGGCACAGCAGG - Intergenic
1179234788 21:39536100-39536122 GCTCTGGTCTCCCGCACAGCCGG - Intergenic
1179722871 21:43325294-43325316 GCTCTTGGCTGACTCAGAGCTGG - Intergenic
1180481603 22:15760582-15760604 GCACTGGACTGGGGCACAGCAGG - Intergenic
953947890 3:47164440-47164462 GCTGGCGACTGACAAACAGCAGG + Intergenic
957890146 3:86346058-86346080 GCTCCCGACTGCCCCAGAGCAGG + Intergenic
962807847 3:138939571-138939593 GCTCTCGACTGCCGGGCGGCGGG - Intergenic
968065918 3:195759405-195759427 GCTCTCGACTGACGCACAGCAGG + Intronic
969395571 4:6918459-6918481 GCCCCTGACTGACACACAGCAGG - Intronic
984122130 4:175758755-175758777 GTCCTCTACTGAGGCACAGCAGG + Intronic
993512424 5:88788039-88788061 GGTCCTGACTGACGCACAGTGGG + Intronic
999779113 5:154834990-154835012 GCTCACTGCTGAGGCACAGCGGG + Intronic
999862408 5:155662611-155662633 GCTCTAGACTGGGGCACAGGAGG + Intergenic
1000916116 5:167083787-167083809 GCTCTGGAATGGCCCACAGCTGG - Intergenic
1005375004 6:25173037-25173059 GCTCTCGTCTGAACCACAGCAGG + Intergenic
1009030236 6:58048201-58048223 TCTCTCCACTCACACACAGCAGG - Intergenic
1009205764 6:60799449-60799471 TCTCTCCACTCACACACAGCAGG - Intergenic
1019454920 7:1122025-1122047 GCCCTCGACTGAGGCTCCGCCGG + Intronic
1022069001 7:26892059-26892081 GCTCTGGAGTGACACAGAGCAGG + Intronic
1026402040 7:70023980-70024002 ACTCTTGACTGGCACACAGCAGG + Intronic
1030999705 7:116400610-116400632 ACTCTGGTCTCACGCACAGCTGG - Intronic
1032073174 7:128822281-128822303 GCTGTCGACTGACTCACAGAGGG + Intergenic
1062123500 9:134847124-134847146 GCTCCCGCCTGGCACACAGCAGG - Intergenic
1203523947 Un_GL000213v1:68720-68742 GCACTGGACTGAGGCACAGCAGG + Intergenic
1203524287 Un_GL000213v1:70089-70111 GCCCTGGACTGTGGCACAGCAGG + Intergenic
1190765597 X:53473299-53473321 CCCCTAGACTGATGCACAGCTGG - Intergenic