ID: 968066195

View in Genome Browser
Species Human (GRCh38)
Location 3:195761160-195761182
Sequence AGGTGGACACAGATGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 250}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968066195_968066205 8 Left 968066195 3:195761160-195761182 CCTTATTCCATCTGTGTCCACCT 0: 1
1: 0
2: 3
3: 26
4: 250
Right 968066205 3:195761191-195761213 CACTTTAGATGGCTTGGAGCGGG 0: 1
1: 0
2: 1
3: 9
4: 106
968066195_968066207 12 Left 968066195 3:195761160-195761182 CCTTATTCCATCTGTGTCCACCT 0: 1
1: 0
2: 3
3: 26
4: 250
Right 968066207 3:195761195-195761217 TTAGATGGCTTGGAGCGGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 123
968066195_968066208 15 Left 968066195 3:195761160-195761182 CCTTATTCCATCTGTGTCCACCT 0: 1
1: 0
2: 3
3: 26
4: 250
Right 968066208 3:195761198-195761220 GATGGCTTGGAGCGGGGCGGTGG 0: 1
1: 0
2: 2
3: 34
4: 601
968066195_968066199 -3 Left 968066195 3:195761160-195761182 CCTTATTCCATCTGTGTCCACCT 0: 1
1: 0
2: 3
3: 26
4: 250
Right 968066199 3:195761180-195761202 CCTCTACCCCTCACTTTAGATGG 0: 1
1: 0
2: 0
3: 11
4: 104
968066195_968066204 7 Left 968066195 3:195761160-195761182 CCTTATTCCATCTGTGTCCACCT 0: 1
1: 0
2: 3
3: 26
4: 250
Right 968066204 3:195761190-195761212 TCACTTTAGATGGCTTGGAGCGG 0: 1
1: 0
2: 0
3: 6
4: 116
968066195_968066211 25 Left 968066195 3:195761160-195761182 CCTTATTCCATCTGTGTCCACCT 0: 1
1: 0
2: 3
3: 26
4: 250
Right 968066211 3:195761208-195761230 AGCGGGGCGGTGGGAGTGCAGGG 0: 1
1: 0
2: 1
3: 24
4: 272
968066195_968066206 9 Left 968066195 3:195761160-195761182 CCTTATTCCATCTGTGTCCACCT 0: 1
1: 0
2: 3
3: 26
4: 250
Right 968066206 3:195761192-195761214 ACTTTAGATGGCTTGGAGCGGGG 0: 1
1: 0
2: 1
3: 4
4: 67
968066195_968066210 24 Left 968066195 3:195761160-195761182 CCTTATTCCATCTGTGTCCACCT 0: 1
1: 0
2: 3
3: 26
4: 250
Right 968066210 3:195761207-195761229 GAGCGGGGCGGTGGGAGTGCAGG 0: 1
1: 0
2: 2
3: 42
4: 526
968066195_968066200 2 Left 968066195 3:195761160-195761182 CCTTATTCCATCTGTGTCCACCT 0: 1
1: 0
2: 3
3: 26
4: 250
Right 968066200 3:195761185-195761207 ACCCCTCACTTTAGATGGCTTGG 0: 1
1: 0
2: 1
3: 7
4: 86
968066195_968066209 16 Left 968066195 3:195761160-195761182 CCTTATTCCATCTGTGTCCACCT 0: 1
1: 0
2: 3
3: 26
4: 250
Right 968066209 3:195761199-195761221 ATGGCTTGGAGCGGGGCGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968066195 Original CRISPR AGGTGGACACAGATGGAATA AGG (reversed) Intronic
900540679 1:3201158-3201180 AGGAGGACAGGGATGGAAAAAGG + Intronic
900648272 1:3718682-3718704 AGTTGGACACAGATGGAGTAAGG - Intronic
901451368 1:9338615-9338637 AGTTGGTCACAGCTGGAAAAGGG + Intronic
901812777 1:11777230-11777252 AGATGGTCACTGATGGAATTCGG + Intronic
901838388 1:11938657-11938679 AGGTGGATTCAGCTGGAGTAGGG + Intronic
903610211 1:24605917-24605939 ATGTGGACACAGTTGGGGTAGGG - Exonic
904334349 1:29787284-29787306 AGGTGGACACAGAAGGACCCTGG - Intergenic
905024159 1:34838361-34838383 CACTGGACACAGATGGAGTAAGG + Intronic
906508756 1:46398850-46398872 AGGAGGACACAGCTGGATGAAGG + Intronic
908173524 1:61531174-61531196 AGGTGAACAGAGATGGGAAAAGG + Intergenic
911559387 1:99385340-99385362 AGGAGTCCACAGAGGGAATATGG - Intergenic
913546209 1:119871511-119871533 AGGTGGAGACAGATGAGAAAAGG + Intergenic
913577588 1:120192663-120192685 AGGTGGACAAAGATGAAAGATGG - Intergenic
914559499 1:148804091-148804113 AGGTGGACAAAGATGAAAGATGG - Intergenic
914613334 1:149326132-149326154 AGGTGGACAAAGATGAAAGATGG + Intergenic
915507279 1:156365980-156366002 AGCTGGTCACAGCTGGAATCTGG + Intronic
916504450 1:165415477-165415499 AGGAGGACAAAGATGGAAGCAGG + Intronic
918289834 1:183096470-183096492 AGATGAACAGAGATGGAATATGG - Intronic
920028506 1:203019982-203020004 AGGTGAAAACACATGGAATGGGG + Intronic
920266120 1:204724486-204724508 AGATGGACATAGACGGAAAAGGG - Intergenic
920712135 1:208305309-208305331 AGGTAGACTAAGAAGGAATAGGG + Intergenic
921046539 1:211481769-211481791 AGCTGGAAACACATGGACTATGG + Intronic
921805407 1:219448568-219448590 AGGTGTAGACAGATGGACAATGG - Intergenic
923784741 1:237055876-237055898 AGGTCCACACAGAGGGAAGATGG + Intronic
924158783 1:241208633-241208655 AGGGGGACACAGGTGAAATAGGG - Intronic
1064362120 10:14675481-14675503 AGGTGGAGACAAATGGAACCAGG - Intronic
1064428817 10:15254148-15254170 GGGTGGACACAGATGGCAGAGGG + Intronic
1067752893 10:48983626-48983648 AGGTGGACACATAGGGACTTGGG + Intergenic
1069984167 10:72272767-72272789 AGGAGGACCCTGATGGAAGAGGG - Intergenic
1074752827 10:116603290-116603312 AGGTGAAGAGAGAGGGAATAGGG - Intronic
1076073690 10:127514542-127514564 ATGTGAACACAGATGGACTCTGG + Intergenic
1076191743 10:128488001-128488023 AAGTGGACAGACATGGAATGGGG + Intergenic
1076743198 10:132498259-132498281 AGATGGTCACAGATGGTATATGG - Intergenic
1079660044 11:23025890-23025912 ATGTGGGGACTGATGGAATAAGG + Intergenic
1080180735 11:29422905-29422927 TGGTGTAGACAGAGGGAATATGG - Intergenic
1080689744 11:34546472-34546494 AGGTGGACAGAGAAGGTATTGGG + Intergenic
1084604709 11:70165700-70165722 AGGAGGACACAGAGGGAAGGTGG + Intronic
1086173151 11:83859374-83859396 AGGTGGTCTCAGATGGAAACGGG + Intronic
1086515176 11:87603787-87603809 AGATGGACACAGGTGGAGCAGGG + Intergenic
1087085269 11:94211895-94211917 AGGTGGAGACTGATGGTAGAGGG + Intergenic
1087438227 11:98150499-98150521 AGGTGGTCTCAGATGAAATCAGG + Intergenic
1087668879 11:101082538-101082560 AGGTGGTCTCAGATGGAGTGAGG + Intronic
1088034929 11:105299921-105299943 ACATGGACACAGATGGAAACAGG + Intergenic
1088520960 11:110699798-110699820 AGGAGGACACTGGAGGAATAGGG - Intronic
1088825881 11:113493989-113494011 ACTTGCACACAGATGAAATATGG + Intergenic
1090735656 11:129610374-129610396 AGGTGTCAACAGATGGGATATGG + Intergenic
1091197889 11:133747386-133747408 AGGGAGACAGAGATGGAATAAGG - Intergenic
1091239928 11:134045603-134045625 AGGTGGACACAGATCAAAGATGG + Intergenic
1091978325 12:4844643-4844665 AGGGTGACACAGATTGCATAGGG + Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1092858543 12:12698422-12698444 ATGTGGATACAGATGGCATCAGG - Intergenic
1092894281 12:12998047-12998069 GGCTGGACACAAATGCAATAAGG - Intronic
1093566369 12:20609781-20609803 AGGAGGACACAGGTGGAAAGGGG + Intronic
1093742472 12:22704469-22704491 TGGTGGAAAAAGATGTAATACGG + Intergenic
1093981128 12:25477012-25477034 GGATGGGCACAGAGGGAATATGG - Intronic
1095256437 12:40041986-40042008 AGGTGGACACAGGTGGATATGGG - Intronic
1097068357 12:56337119-56337141 AGGTGGACACCAATGGAATAAGG - Intronic
1097166613 12:57089469-57089491 GGGTGGAGACTGATGGAAAAGGG + Intronic
1098467212 12:70801196-70801218 AGTTGGAAACAGATGGAGTTGGG + Intronic
1098693782 12:73525622-73525644 ACTAGGACACAGAAGGAATATGG + Intergenic
1099782315 12:87212346-87212368 AGCTGGATACAGATGGAGTAGGG - Intergenic
1100649222 12:96566539-96566561 ACGTGGATACAGATTGAGTAGGG + Intronic
1100769424 12:97905338-97905360 AGGTGAAGACAGATTGAATGTGG + Intergenic
1101235199 12:102781619-102781641 AGATAGAGACAGATGGACTAGGG - Intergenic
1102417729 12:112779156-112779178 AGGTGGCCAGAGAAGGCATAAGG + Intronic
1102531733 12:113551666-113551688 GGGTGGGCACAGAAGGAAGAAGG - Intergenic
1103945551 12:124524356-124524378 AGGTGGCCAAAGAAGGGATAAGG - Intronic
1104970315 12:132528005-132528027 AGGGGGACAAAGATGGAGGAGGG - Intronic
1104996933 12:132664115-132664137 AGCTGGACACAGATGGTATATGG - Exonic
1105428150 13:20313492-20313514 AGGATGGCACAGATGGAAAAGGG + Intergenic
1105804514 13:23945385-23945407 AGGTGGATACAGATGTAAAACGG + Intergenic
1106926240 13:34615992-34616014 AGTTGGGCACAAAAGGAATAGGG - Intergenic
1107295746 13:38905486-38905508 ATGTGGACACATAAGGAGTAAGG - Intergenic
1110559844 13:76899022-76899044 AGGTGGTCTCAGATGAAATGGGG - Intergenic
1111163067 13:84420782-84420804 AGGTGGTCTCAGATGGAAATGGG + Intergenic
1111958559 13:94784129-94784151 AGATGCACACAGAGGGAAGAAGG + Intergenic
1112464256 13:99629699-99629721 AAGTGGACACAGATGGGATTGGG + Intronic
1113611387 13:111647035-111647057 AGGTGGACAGAGGTGGAAAGGGG - Intronic
1113933271 13:113979846-113979868 AGGTGCACACACATGGTATGAGG - Intronic
1114666137 14:24378130-24378152 AGTTGGAAAGAGATGGAATGTGG + Exonic
1118590404 14:67396670-67396692 ATGTGGGCAAAGATGGAACAAGG - Intronic
1120051229 14:79868645-79868667 AGGTGGGCACAGATAAAACAAGG - Intergenic
1120248002 14:82028369-82028391 AGGTGGTCTCAGATGGAAATGGG - Intergenic
1120645705 14:87071521-87071543 TGGGGAACACAGATGGAGTAGGG + Intergenic
1122121309 14:99554930-99554952 AGGTGGGCACAGATGGACATAGG + Intronic
1125307968 15:38343682-38343704 AGGTAGACACAGATTGTACAAGG + Intronic
1125394991 15:39236960-39236982 AGGTAGAGACAGTTGGATTATGG + Intergenic
1125730005 15:41887798-41887820 AAGTGGACACAGATGTAGAAAGG - Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1128399400 15:67262324-67262346 AGGTGGAGATTGATGGAAGATGG - Intronic
1129938276 15:79469663-79469685 AGGTGGAAACAGATCAAATTTGG - Exonic
1130733451 15:86523327-86523349 ACTTGGACACAGAGGGAAGATGG - Intronic
1131975041 15:97935791-97935813 AGGTGGACAAGGAATGAATATGG + Intergenic
1132392718 15:101450656-101450678 AGCTGGACACAGATGGGATGGGG - Intronic
1136531444 16:30872347-30872369 TGGTGCCCACAGGTGGAATAGGG + Intronic
1137284863 16:47007101-47007123 AAATAGACACAGATGCAATAGGG + Intergenic
1138216666 16:55210714-55210736 AGGTGAATACAGAAGGAATAAGG + Intergenic
1138447292 16:57072167-57072189 AGGTGGACAGAGAAAGAGTAAGG - Intronic
1138750267 16:59410922-59410944 AGGTGGACAGAGAGTGCATAGGG + Intergenic
1144272951 17:13636923-13636945 ACGTGGACACAGGTGGAGTGAGG + Intergenic
1145215439 17:21048059-21048081 AGGTGCAGACACATGGAAAAAGG + Intergenic
1148438998 17:47702210-47702232 AGGTGGAAACAGAAGAAAGAGGG - Intronic
1149375120 17:56035988-56036010 AGGAGCACACAGATGGTAGAAGG - Intergenic
1150571841 17:66393621-66393643 ACGTGCACACACATGGAAGAAGG - Intronic
1151365668 17:73614647-73614669 AGGGGGACAAAGATTGAAAAGGG + Intronic
1151541025 17:74764567-74764589 AGGAAGACACAGCTGGAATCTGG + Intronic
1152048254 17:77953184-77953206 AGGAGCACACCGATGGAATCAGG - Intergenic
1163717204 19:18879480-18879502 AGGTGGGCAAGGATGGGATAAGG - Intronic
1164491702 19:28720703-28720725 AAGTGGAGGGAGATGGAATAGGG - Intergenic
1164720214 19:30426449-30426471 AGAAGAACAAAGATGGAATAAGG - Intronic
1165080785 19:33304781-33304803 AGGAGGAGACAGAAGGAGTAGGG + Intergenic
1165781958 19:38440087-38440109 AGTGGGACACAGATGGACCAAGG - Intronic
1166048781 19:40245743-40245765 GGGTGGACATAGATGGGTTATGG - Intronic
1167373827 19:49100868-49100890 AGGAGGACACAAATGGAATTAGG - Intronic
1167575350 19:50315198-50315220 AGATGGACAGAGATGGACCAAGG + Intronic
1167730333 19:51249573-51249595 AGGTGGAGACTGTTGTAATAGGG + Intronic
1167857683 19:52256044-52256066 AGGTGGACAAAGAAGCATTATGG - Intergenic
1168502064 19:56901036-56901058 AGGTGGATTCAGATGCAACAGGG + Intergenic
1168555944 19:57339985-57340007 ATGTAGACACAAATGGATTAGGG + Intergenic
926918794 2:17918812-17918834 AGGTGTACACAAATGGGCTATGG + Intronic
927928383 2:27028232-27028254 AGGAGAACAGAGATAGAATAAGG - Intergenic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
929898576 2:45982623-45982645 AGGAGGACACAGATACAATGGGG - Intronic
931716964 2:65037023-65037045 AAATGGACAAAGATGGAGTATGG - Intergenic
931845004 2:66194188-66194210 AGGGGGACACACATGGAAGGGGG + Intergenic
932226942 2:70048904-70048926 AGAGGGACACAGAGGGAAGATGG - Intergenic
932461294 2:71883547-71883569 AGGTGAAAACAGAGGGCATAAGG + Intergenic
932824247 2:74925388-74925410 GGGGGGACACAGTTGGAAAAAGG - Intergenic
937482514 2:122277166-122277188 AGGTGGACAGATATGGCTTATGG + Intergenic
937620521 2:123980037-123980059 AGGTGGTCTCAGATGGAAACAGG + Intergenic
938560529 2:132468713-132468735 AGGTGGTTACAGATGGAAGGTGG + Intronic
938928939 2:136069093-136069115 AGGTGAACACAGAGGTAGTAGGG + Intergenic
941974980 2:171393684-171393706 AGGTGGAAACAGATGCTAAAAGG + Intronic
944402658 2:199345891-199345913 GGATGGACACAGATTGAAAAAGG - Intronic
946707867 2:222476350-222476372 AGGTGGTGACAGAGGGACTAGGG + Intronic
947845189 2:233238022-233238044 ATGTGGACACAGCTTGAATGTGG + Intronic
948490263 2:238308311-238308333 AAGTGGACACACTTGGCATATGG - Intergenic
1170922851 20:20695483-20695505 AGGTTGACTCATATGGACTAAGG - Intronic
1171847899 20:30288847-30288869 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1172647648 20:36481200-36481222 AGCTGGCCAAAGATGGAAGAAGG - Intronic
1175774366 20:61643800-61643822 AGGGGAACTCAGATGGATTAAGG - Intronic
1176043691 20:63081544-63081566 ATGTGGACACACATGGACAAGGG + Intergenic
1177353734 21:19979922-19979944 AGGTTAACACAGTTAGAATAGGG - Intergenic
1178793524 21:35722233-35722255 AGGCTAACACAGATGGGATAAGG - Intronic
1179540860 21:42082606-42082628 AGGAGGACACAGAGGGAGGAGGG - Intronic
1180086263 21:45509284-45509306 AGGAGGACACAGATGGAGGAGGG + Intronic
1181293906 22:21819591-21819613 AGGTGGCCACAAATGCCATAAGG + Intronic
1182949480 22:34358780-34358802 AGATTGAAACAGATGGCATATGG + Intergenic
1183091733 22:35526918-35526940 TGGTGGACAGAGCTGGAACAAGG + Intergenic
1183226251 22:36551886-36551908 AGGTTCACACAGCAGGAATATGG - Intergenic
949185252 3:1183646-1183668 AGGTTGCCAGAAATGGAATAAGG - Intronic
949895130 3:8762882-8762904 AGCTGGACTCAGGAGGAATAGGG - Intronic
952594309 3:34997420-34997442 GGGTGGAAATAGATGTAATATGG + Intergenic
954098964 3:48354934-48354956 AGGTGCACTCAGAAGGTATATGG - Intergenic
954484705 3:50836978-50837000 AGGTGGTCTCAGATGGAGAAGGG - Intronic
954954441 3:54507149-54507171 GGGTGGACAGAGGTGGAAAATGG - Intronic
955198993 3:56832499-56832521 GGGTGGCCAAAGATGGAATGTGG - Intronic
955433504 3:58874238-58874260 AAGTGGACATGGATGGGATATGG - Intronic
955441216 3:58956936-58956958 AGGTGGAGACAGTTGGATCATGG - Intronic
957099114 3:75806513-75806535 AGGGGGAGACAGAGGGATTATGG - Intergenic
959235743 3:103719288-103719310 AGGTGGTCTCAGATGAGATAAGG - Intergenic
959785756 3:110295448-110295470 AGGTGGTCTCAGATGGAATGAGG - Intergenic
959924517 3:111906502-111906524 AGATGGACAAAGATAGAAGAGGG + Intronic
960196203 3:114771743-114771765 ACGTGGACAAAGAGGGGATAAGG - Intronic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
964256140 3:154776653-154776675 AGGTGGTCACAGCAGGAACAAGG + Intergenic
964488837 3:157213292-157213314 AGGAGGGCACAGAAGGAAGATGG + Intergenic
964634287 3:158843392-158843414 AGCAGGACAGTGATGGAATATGG + Intergenic
965691095 3:171357856-171357878 AGATGGACACAGTGGGAATCAGG + Intronic
965780564 3:172281489-172281511 AGGTGGAATCAGGTGGAAAATGG + Intronic
966228348 3:177622809-177622831 AGGAGGAGTCAGATGGAATTAGG + Intergenic
968066195 3:195761160-195761182 AGGTGGACACAGATGGAATAAGG - Intronic
969118652 4:4890591-4890613 AGATGGACAGAGGTGGAATTTGG - Intergenic
969134571 4:5019777-5019799 AGGAGGACAGAGATGGAAGGAGG + Intergenic
970497440 4:16641069-16641091 AGATGGACATAGATGGAAACTGG + Intronic
971736888 4:30465145-30465167 AGTTGGATACAGATGAAATCTGG + Intergenic
972301756 4:37791514-37791536 AGGTGGTCTCAGCTGGAATAAGG + Intergenic
974095463 4:57359136-57359158 AGGAGGAGACGTATGGAATAAGG + Intergenic
974225669 4:59039620-59039642 ATGTGTTCACAGATGGAAAAAGG - Intergenic
974716798 4:65678366-65678388 AGGTGGTCTCAGATGGAGAAGGG + Intergenic
975981608 4:80167003-80167025 AGGTGCATACAGATTGAAGATGG + Intergenic
977913789 4:102567163-102567185 AGGTAGGAACAGATAGAATATGG + Intronic
978698605 4:111615405-111615427 AAGTGGACAGAGATTGAGTAAGG - Intergenic
979257508 4:118620318-118620340 AGATGCACACAGATGGGATTTGG + Intergenic
979330843 4:119420229-119420251 AGATGCACACAGATGGGATTTGG - Intergenic
979411381 4:120384009-120384031 AGGTGGTCTCAGATGGAAATGGG + Intergenic
979474020 4:121133811-121133833 ATTTGGACACAGATGGAAGATGG + Intronic
981527361 4:145720097-145720119 AGGTGGCAACAGGTGGATTAGGG + Intronic
981953200 4:150436363-150436385 AGGTTGTCCCAAATGGAATAAGG - Intronic
982235785 4:153249859-153249881 ATGTGGACACGGATGCAATCAGG + Intronic
982806969 4:159778288-159778310 AGGTGAACACAAATGTATTATGG - Intergenic
983419689 4:167501432-167501454 AGGTGGTCTCAGATGGGATGAGG - Intergenic
984194862 4:176646980-176647002 AGGTTCACACAGATGATATAGGG + Intergenic
984725191 4:183013618-183013640 AGGTGGAGACTGATGGCAGAGGG + Intergenic
987653992 5:20782534-20782556 AGATGAACGCAGATGGAAAAGGG + Intergenic
988741583 5:34078958-34078980 AGATGAACGCAGATGGAAAAGGG - Intronic
989026444 5:37073810-37073832 AGATGGAGAGAGATGGGATAAGG - Intergenic
989826384 5:45861741-45861763 AGGTGAACACATATGGAAGAGGG + Intergenic
990762980 5:59151072-59151094 ACATGGACACAGGTGGACTAGGG - Intronic
990849660 5:60188460-60188482 AGGAGGAGACAGATGGAGAAAGG - Intronic
992615579 5:78543327-78543349 ACGTGGACACACAAGGAATGAGG - Intronic
993691281 5:91003830-91003852 CGGTGGACTCAGATGTAAGAAGG + Intronic
995199952 5:109414528-109414550 AGGTGGTCTCAGATGGAGAAGGG + Intergenic
995361384 5:111302126-111302148 AGCTGGACACTGAGAGAATATGG - Intronic
995615930 5:113964387-113964409 AGGTGAACATTGATGGAAAATGG - Intergenic
1001405976 5:171477959-171477981 AACTGGAGACAGGTGGAATAGGG - Intergenic
1001984660 5:176062559-176062581 AGGTGGATACGGATGTAAAACGG - Intronic
1002232853 5:177781638-177781660 AGGTGGATACGGATGTAAAACGG + Intronic
1002263135 5:178008177-178008199 AGGTGGATACGGATGTAAAACGG - Intronic
1002426587 5:179180370-179180392 AGGAGGCCACAGATTTAATACGG + Intronic
1003254082 6:4459350-4459372 AGGTGGATACAGATTTGATAAGG + Intergenic
1003670755 6:8155989-8156011 AGATGGACATAGATGAAACATGG + Intergenic
1008892503 6:56511445-56511467 AGGTGTAGACAGCTGTAATATGG - Intronic
1010454155 6:76035538-76035560 AGGTGAACACAGATTGTGTAGGG + Intronic
1011031555 6:82929793-82929815 GTGTGGATACAGAGGGAATATGG - Intronic
1014910132 6:127082212-127082234 AGATGAACAGAAATGGAATATGG + Intergenic
1016627803 6:146192867-146192889 AGGTGGGCACAGCTGGAAGAAGG + Intronic
1016686645 6:146889628-146889650 AGGTGGACATAGAAGGTCTATGG + Intergenic
1016689221 6:146916647-146916669 AGGTGGACACAGATGGTCACAGG - Intergenic
1018807941 6:167275736-167275758 AGCTGGACACAGATGAAAGCAGG - Intronic
1020152597 7:5695046-5695068 ATGGGGACACAGATGGGTTAGGG + Intronic
1020480540 7:8654820-8654842 AGGTGGGCACAGAAGAAAGAAGG + Intronic
1022243776 7:28537489-28537511 AGGTGTACAAAGATGGGAGATGG + Intronic
1022301438 7:29106140-29106162 AGGTGGACACAGAGAGACTCAGG + Intronic
1023125559 7:36951075-36951097 AGGTGGCAACAGTAGGAATAAGG - Intronic
1025081551 7:55987796-55987818 AGCTGGGCAGAGAGGGAATACGG + Intronic
1026019586 7:66697071-66697093 TGGTTGACACAGAGGGAAGATGG - Intronic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026297888 7:69071397-69071419 CCATGGACACAGATGGAAGAGGG - Intergenic
1031344461 7:120648504-120648526 AGATGGAGAAAGATGGAAGAAGG + Intronic
1032094857 7:128932892-128932914 AGGTGGGCTCAGATGGGAAACGG - Intergenic
1032877595 7:136054144-136054166 AGGAGGACACAGACGGAGTGGGG + Intergenic
1033156049 7:138957854-138957876 AAGTGGACAAAGAGAGAATAAGG - Intronic
1033456502 7:141508302-141508324 AGGTGGTCTCAGATGGAGTGAGG - Intergenic
1034037383 7:147838659-147838681 AGGTAGTCTCAGATGGAATGAGG - Intronic
1036054024 8:5230212-5230234 AGGTGGACCCTGATGGATTATGG + Intergenic
1036758987 8:11494007-11494029 TGGTGCACACAGATGGCACATGG + Exonic
1037125640 8:15345323-15345345 AGATAGACAGGGATGGAATAAGG + Intergenic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1038381189 8:27095914-27095936 ACATGGACACATAAGGAATAAGG - Intergenic
1038761405 8:30386179-30386201 AGGTGAACACAGAAGGTAAACGG + Intronic
1039407712 8:37327230-37327252 AGTTGTAAACAGATGGAACAAGG - Intergenic
1042712449 8:71733633-71733655 AGGCGGATACAGATGGGACATGG + Intergenic
1042803874 8:72750987-72751009 AACTGGAGACAGATTGAATAAGG - Intronic
1044108775 8:88245554-88245576 AGGTGAACACAAGAGGAATATGG + Intronic
1044772284 8:95648949-95648971 AGGTGGATACTGGTGGAAAAAGG - Intergenic
1045194921 8:99920931-99920953 AGATGGACACAGCTGAAAAAGGG - Intergenic
1048952666 8:139509217-139509239 TTGAGGACACAGAAGGAATAGGG + Intergenic
1049174713 8:141184778-141184800 AGGTGGACACAGAGGGAGGGAGG - Intronic
1049932357 9:469711-469733 AGGTGGACACAGGTGGGCTGCGG - Intergenic
1051531785 9:18112247-18112269 AGGTGAACTCAGATGGACTAAGG - Intergenic
1052224053 9:26062626-26062648 ATGTGCACAAAGATGGAAGAGGG + Intergenic
1053007411 9:34613228-34613250 AGGTGGACACAGAAGAAAAAAGG - Intergenic
1053786034 9:41653497-41653519 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1054159016 9:61660699-61660721 AGGTGGAGACAGAAGGAGTCAGG + Intronic
1054174750 9:61867430-61867452 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1054478790 9:65591704-65591726 AGGTGGAGACAGAAGGAGTCAGG + Intergenic
1054662788 9:67713363-67713385 AGGTGGAGACAGAAGGAGTCAGG + Intergenic
1054905419 9:70410675-70410697 AGGTGGGCAGAGATGGCATTTGG - Intronic
1057349180 9:94280448-94280470 AGTTGGTCACAGACAGAATAAGG - Intronic
1057392921 9:94654105-94654127 AGGTGGAGAAGGATGGAAAATGG + Intergenic
1057967703 9:99520099-99520121 TGTTGGAGACAGATTGAATATGG - Intergenic
1058910590 9:109516924-109516946 AGGTGAGCAGGGATGGAATAGGG + Intergenic
1203344901 Un_KI270442v1:27001-27023 AAGTGGAATCAAATGGAATACGG + Intergenic
1185995199 X:4939385-4939407 AGATGGAGATAGATGGAACATGG - Intergenic
1187221141 X:17327460-17327482 AGGTGGATACAGAGAGGATATGG - Intergenic
1187397188 X:18928830-18928852 AGGTGGACACAGGTGAAAGGCGG + Intronic
1187754447 X:22506355-22506377 AGAAGGATACAGATGCAATAAGG - Intergenic
1188457059 X:30379259-30379281 AGGTGGTCTCAGATGGAAATGGG + Intergenic
1190877528 X:54470468-54470490 TGGTGGACACACATGGAAGCAGG + Intronic
1191756643 X:64600016-64600038 AGGTGGATAGAGGTGGAAGAGGG - Intergenic
1192511427 X:71722654-71722676 AGGGAGACACAGAGGGAGTATGG - Intergenic
1192515270 X:71758851-71758873 AGGGAGACACAGAGGGAGTATGG + Intergenic
1193250284 X:79282443-79282465 AGGTGGTCTCAGATGAGATAAGG - Intergenic
1193668315 X:84351602-84351624 AGGTGCAAACAAATGGAAAAAGG - Intronic
1195443987 X:104929749-104929771 AGGTGGATGCAGAAGGAATATGG - Intronic
1196154818 X:112417211-112417233 AAGTGGGCACAGATTGAAGATGG + Intergenic
1196755187 X:119151234-119151256 AGATGGAGACAGAGGGAAAAGGG - Intergenic
1197127100 X:122959545-122959567 AGATGCACACAGAAGGAAGATGG + Intergenic
1199069427 X:143459174-143459196 AGGTGCACACAGCTGGATTTGGG + Intergenic