ID: 968066472

View in Genome Browser
Species Human (GRCh38)
Location 3:195762115-195762137
Sequence CTCGGGCGGGAGGCTGGCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 448}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968066456_968066472 11 Left 968066456 3:195762081-195762103 CCTCACCCAGGAGCCCCTCCGTG 0: 1
1: 0
2: 3
3: 29
4: 342
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066462_968066472 -3 Left 968066462 3:195762095-195762117 CCCTCCGTGCGGTTCTGGTACTC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066463_968066472 -4 Left 968066463 3:195762096-195762118 CCTCCGTGCGGTTCTGGTACTCG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066466_968066472 -7 Left 968066466 3:195762099-195762121 CCGTGCGGTTCTGGTACTCGGGC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066454_968066472 15 Left 968066454 3:195762077-195762099 CCGCCCTCACCCAGGAGCCCCTC 0: 1
1: 0
2: 4
3: 60
4: 750
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066461_968066472 -2 Left 968066461 3:195762094-195762116 CCCCTCCGTGCGGTTCTGGTACT 0: 1
1: 0
2: 1
3: 1
4: 46
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066458_968066472 6 Left 968066458 3:195762086-195762108 CCCAGGAGCCCCTCCGTGCGGTT 0: 1
1: 0
2: 1
3: 4
4: 57
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066455_968066472 12 Left 968066455 3:195762080-195762102 CCCTCACCCAGGAGCCCCTCCGT 0: 1
1: 0
2: 3
3: 23
4: 278
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066453_968066472 20 Left 968066453 3:195762072-195762094 CCGAGCCGCCCTCACCCAGGAGC 0: 1
1: 0
2: 3
3: 22
4: 304
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066459_968066472 5 Left 968066459 3:195762087-195762109 CCAGGAGCCCCTCCGTGCGGTTC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968066472 Original CRISPR CTCGGGCGGGAGGCTGGCGG AGG Exonic