ID: 968066472

View in Genome Browser
Species Human (GRCh38)
Location 3:195762115-195762137
Sequence CTCGGGCGGGAGGCTGGCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 448}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968066459_968066472 5 Left 968066459 3:195762087-195762109 CCAGGAGCCCCTCCGTGCGGTTC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066454_968066472 15 Left 968066454 3:195762077-195762099 CCGCCCTCACCCAGGAGCCCCTC 0: 1
1: 0
2: 4
3: 60
4: 750
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066461_968066472 -2 Left 968066461 3:195762094-195762116 CCCCTCCGTGCGGTTCTGGTACT 0: 1
1: 0
2: 1
3: 1
4: 46
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066463_968066472 -4 Left 968066463 3:195762096-195762118 CCTCCGTGCGGTTCTGGTACTCG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066458_968066472 6 Left 968066458 3:195762086-195762108 CCCAGGAGCCCCTCCGTGCGGTT 0: 1
1: 0
2: 1
3: 4
4: 57
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066453_968066472 20 Left 968066453 3:195762072-195762094 CCGAGCCGCCCTCACCCAGGAGC 0: 1
1: 0
2: 3
3: 22
4: 304
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066462_968066472 -3 Left 968066462 3:195762095-195762117 CCCTCCGTGCGGTTCTGGTACTC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066456_968066472 11 Left 968066456 3:195762081-195762103 CCTCACCCAGGAGCCCCTCCGTG 0: 1
1: 0
2: 3
3: 29
4: 342
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066466_968066472 -7 Left 968066466 3:195762099-195762121 CCGTGCGGTTCTGGTACTCGGGC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448
968066455_968066472 12 Left 968066455 3:195762080-195762102 CCCTCACCCAGGAGCCCCTCCGT 0: 1
1: 0
2: 3
3: 23
4: 278
Right 968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 29
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968066472 Original CRISPR CTCGGGCGGGAGGCTGGCGG AGG Exonic
900610735 1:3543567-3543589 CCCGGGCGGGAGGCGGGGCGAGG + Intronic
900629293 1:3625162-3625184 CCCGGGCGGGGGGCGGCCGGGGG + Exonic
901441232 1:9279732-9279754 CTCGGTGGGGAGGCTGCCGCTGG - Intergenic
901642721 1:10701217-10701239 CCCGGGCAGGAGGCAGGAGGAGG - Intronic
902630686 1:17702746-17702768 CTGGGGGTGGAGGCTGGTGGGGG - Intergenic
902737155 1:18408820-18408842 CTAGGGCGTGATGCTGGAGGTGG - Intergenic
904334236 1:29786618-29786640 CTCTGGCTGGAGGCAGGTGGCGG - Intergenic
904620764 1:31773691-31773713 CTGTGGCGGGGGGTTGGCGGGGG - Intergenic
905449157 1:38046209-38046231 CCTGGCCGGGATGCTGGCGGCGG - Exonic
905474155 1:38214015-38214037 CTGGGGCGAGAGGGTGGAGGGGG + Intergenic
906325594 1:44843416-44843438 CGCGGGCGGGAGGGAGGCGCGGG - Intergenic
906614689 1:47226040-47226062 CTAGGGCGGGAGGCCGGTTGGGG + Intronic
906714485 1:47956638-47956660 GGCGGCAGGGAGGCTGGCGGAGG + Intronic
907400225 1:54220708-54220730 ACTGGGCGGGAGGCTGGCTGAGG - Intronic
908669747 1:66533340-66533362 CTGGGGCGGGAGGCTGGAAAGGG - Intergenic
908983485 1:69987131-69987153 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
909463041 1:75941361-75941383 CTTTGGTGGGAGGCTGGGGGAGG - Intergenic
909640830 1:77869578-77869600 CTCGTCCGGGAGGGTGGTGGGGG - Intronic
909640902 1:77869744-77869766 CCCGTCCGGGAGGCAGGCGGGGG - Intronic
910138388 1:83999063-83999085 CACGGGCGGTGGGCGGGCGGAGG - Exonic
910449063 1:87328767-87328789 CGCGGGAGGGAGGAAGGCGGCGG + Exonic
911527711 1:99005380-99005402 CCGGGGCTGGAGCCTGGCGGTGG + Intergenic
912568700 1:110606745-110606767 CTGGGGCGGCAGCCTGGCGCAGG - Intronic
912807885 1:112772586-112772608 ATAGGGCGGGAGGCTGGGCGCGG - Intergenic
914702822 1:150149950-150149972 GCCGGGCGGGCGGGTGGCGGGGG + Intronic
917383932 1:174447893-174447915 TTCGGGCGGGGGGGTGGGGGGGG - Intronic
919978057 1:202625689-202625711 CCTGGGAGGGAGCCTGGCGGGGG - Intronic
920609694 1:207424497-207424519 CTGGGGCGGGCGGGGGGCGGGGG + Intergenic
920704986 1:208244237-208244259 CTGGAGCGGGAGGGCGGCGGAGG - Exonic
920805759 1:209231966-209231988 CGCGCGCGGGAGGCTTGCAGAGG + Intergenic
921754354 1:218836794-218836816 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
922727090 1:227927601-227927623 CTAGGGCGGGAGGCAGGCGGGGG + Intronic
923630912 1:235649348-235649370 CTCCGGCATGAGGCAGGCGGGGG - Intronic
1062843784 10:689684-689706 CGGGCGCGGGAGGCGGGCGGCGG + Intronic
1065260986 10:23923091-23923113 CTCGGGGGGAAGGCTGGGAGTGG - Intronic
1065510992 10:26478338-26478360 GTGGGGCGGGAGGATGGAGGCGG + Intronic
1067060636 10:43076491-43076513 CTGGGGCCGGAGGCAGGAGGCGG - Intergenic
1067830745 10:49610016-49610038 CGCGGGCGGGGGGCAGGCAGGGG + Intronic
1068773678 10:60849468-60849490 CTGGGCCAGGAGGGTGGCGGTGG - Intergenic
1069557774 10:69408859-69408881 AGGGGGCGGGGGGCTGGCGGGGG - Intronic
1070742832 10:78913746-78913768 CTCGGGCGGGCGGGAGGCAGTGG + Intergenic
1071004353 10:80865357-80865379 GTAGGGTGGGAGGCTGGGGGAGG - Intergenic
1071455711 10:85850048-85850070 CTTGGGCAGGAGGGTGGGGGAGG - Intronic
1072549906 10:96469531-96469553 CCCAGGCGGGAGGCTGGTGGTGG - Intronic
1073503878 10:103967182-103967204 CTGGGGAGGGAGACAGGCGGCGG + Exonic
1074086430 10:110211330-110211352 CTGGGGCCGGAGGCTGGGTGGGG + Intronic
1074182481 10:111076893-111076915 CGCGGGCGCTAGACTGGCGGAGG + Intergenic
1075710935 10:124530204-124530226 GTGGGGCGGGAGGCAGGAGGCGG - Intronic
1076089375 10:127668514-127668536 CACGGGTGGGGGGCTGGGGGAGG - Intergenic
1076791503 10:132779207-132779229 CTCGGCCTGGAGCCTGGCTGTGG + Intronic
1076880259 10:133236414-133236436 CTCAAGGGGGAGGCTGGCGGGGG - Intergenic
1076930670 10:133529717-133529739 CGCGGGCTGGTGGCGGGCGGGGG + Intronic
1077230214 11:1455325-1455347 CTGGGGAGGCAGGCTGGGGGCGG - Intronic
1077360641 11:2138956-2138978 CTCGGGAGGGGGACAGGCGGTGG + Intronic
1078699585 11:13668379-13668401 TGCGGCCGGGAGGCTCGCGGGGG - Intergenic
1080034516 11:27699084-27699106 TGGGGGCGGGAGGCTGGGGGTGG - Intronic
1081040436 11:38203368-38203390 CGGGGGTGGGAGGCTGGGGGAGG + Intergenic
1081611442 11:44565547-44565569 CTCGGGGGCGGGGCCGGCGGAGG + Intronic
1081821364 11:45998932-45998954 TTCGGGAGGGAGGCTGAGGGAGG - Intronic
1083197968 11:61102315-61102337 CTTGGGCAGGAAGCTGGCAGAGG + Intergenic
1083374096 11:62205632-62205654 CTCGGGCGCGAGGGAGGCGCTGG + Intergenic
1083857700 11:65401311-65401333 CTGGGGAGGGAGGCTGGGGAGGG - Intronic
1084743402 11:71153282-71153304 CTCGGGCGGGTCGGGGGCGGGGG + Intronic
1084758665 11:71254363-71254385 CTTGGGTGGAAGGCTGGCAGAGG - Intergenic
1084787746 11:71453260-71453282 CTTGGGCAGGAGGCCAGCGGGGG - Exonic
1084942535 11:72620649-72620671 CCCGGTCGGGAGGGTGGGGGTGG - Intronic
1085296584 11:75434929-75434951 CTGGGGCAGGGGGTTGGCGGTGG + Exonic
1085960577 11:81456755-81456777 ATGGGGTGGGAGGCTGGGGGAGG + Intergenic
1087093756 11:94300716-94300738 CTCGGGAGGGAGGCTGAGGTGGG + Intergenic
1090385937 11:126357571-126357593 CGAGGTTGGGAGGCTGGCGGGGG - Intronic
1091077495 11:132633895-132633917 CGGGGGTGGGAGGCTGGGGGTGG + Intronic
1091761290 12:3088874-3088896 CAGGCGCGGGAGGCTGGTGGTGG + Intronic
1093896935 12:24584333-24584355 GTGGGGCGGGAGGGTGGGGGTGG - Intergenic
1096435135 12:51583393-51583415 GTGGGGTGGGAGGCTGGGGGAGG + Intergenic
1096660817 12:53122998-53123020 GCCGGGCGGGGGGCTGGAGGTGG + Intronic
1096675488 12:53223518-53223540 CTTGGGCGGGGGGGGGGCGGGGG - Intronic
1096885671 12:54716820-54716842 CTGGAGAGGGGGGCTGGCGGGGG - Intergenic
1097003888 12:55901204-55901226 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1097106456 12:56629190-56629212 TTCCTGCGGGAGGCTGGGGGAGG + Intronic
1097787718 12:63779780-63779802 CCTGGGCGGGAGGCGGGCGGTGG + Intergenic
1098964544 12:76772966-76772988 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1100362928 12:93894711-93894733 CACGGGCCGGCAGCTGGCGGGGG - Intronic
1101428364 12:104606162-104606184 CTGGGGCGGGGGGCGGGGGGGGG + Intronic
1101628061 12:106465605-106465627 CTGGGGTGGGAGGCTAGGGGAGG - Intronic
1102101275 12:110281013-110281035 CGCGGTCGCGGGGCTGGCGGAGG - Intronic
1102197317 12:111034551-111034573 CTCGGGCAGGGGGCTGCTGGCGG + Intronic
1103857812 12:123986107-123986129 GTCTGGCGGGGGGCTGGAGGGGG + Intronic
1104003072 12:124872838-124872860 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1104159973 12:126168621-126168643 CTAAGGTGGGAGGCTGGCTGGGG + Intergenic
1104350104 12:128037809-128037831 CTCGGGTGGGTGGCTGGATGAGG + Intergenic
1104948316 12:132427336-132427358 CTGGGGCGGGTGGCCGGTGGGGG + Intergenic
1105937733 13:25117590-25117612 CTGGGGCGGGGGGTTTGCGGTGG - Intergenic
1106157416 13:27171529-27171551 CTCGGGCGGGCGGGCGGCGCTGG - Intronic
1106229926 13:27813950-27813972 CAGGGGCAGGAGGGTGGCGGGGG - Intergenic
1106975768 13:35211705-35211727 CTCGGGAGGGAGGCTAGGGCAGG + Intronic
1108287623 13:48924458-48924480 CTCGGGAGGGAGGCTGAGGTGGG - Intergenic
1108541695 13:51452348-51452370 CGCGGGCGGCAGGGTGGGGGAGG - Intronic
1109396649 13:61766867-61766889 CTCAGGTGGGAGGCTGCAGGTGG + Intergenic
1110442102 13:75537615-75537637 CGTGGGAGGCAGGCTGGCGGAGG + Intronic
1112983049 13:105410366-105410388 CTCGGGAGGGAGGCTGAAGCAGG + Intergenic
1113420089 13:110164553-110164575 CTGGAGCGGGAGGCAGGAGGGGG + Intronic
1113868217 13:113543056-113543078 GTAGGGCGGGAGGCAGGGGGAGG - Intronic
1115474355 14:33799707-33799729 GTGGGGCGGGGGGCCGGCGGTGG - Intronic
1115767352 14:36637105-36637127 GTGGGGTGGGAGGCTGGGGGAGG - Intergenic
1116897923 14:50335195-50335217 CTAAGGCGGGAGGATGGCGTGGG + Intronic
1116928611 14:50668058-50668080 CTCGGGAGGGAAGGAGGCGGCGG - Exonic
1117474594 14:56081101-56081123 CTCTGGCAGGAGACTGGAGGAGG - Intergenic
1117647166 14:57865269-57865291 CTCGGGGGTGGGGCTGGCGGGGG - Intronic
1118334817 14:64843896-64843918 CTGGGATGGGAGGCTGGTGGTGG - Intronic
1118925704 14:70188533-70188555 CCCCGGCGGGAGGGCGGCGGCGG - Exonic
1120765209 14:88322592-88322614 CGCGGGTGGGAGGAGGGCGGAGG - Intronic
1122130860 14:99604043-99604065 CGCGGGCGGGGGGCGGCCGGGGG + Intergenic
1122418421 14:101561129-101561151 CGCGGGCCGGAGCCAGGCGGCGG + Intergenic
1122779791 14:104138781-104138803 CTGGAGAGGGAGGCGGGCGGCGG + Intronic
1122959604 14:105088345-105088367 CCCGGGCGGAGGGCTGGGGGCGG + Intergenic
1123468081 15:20530772-20530794 CACGGTGGGGAGGCTGGAGGAGG + Intergenic
1123650031 15:22470270-22470292 CACGGTGGGGAGGCTGGAGGAGG - Intergenic
1123728397 15:23125981-23126003 CACGGTGGGGAGGCTGGAGGAGG + Intergenic
1123740437 15:23279112-23279134 CACGGTGGGGAGGCTGGAGGAGG - Intergenic
1123746561 15:23323446-23323468 CACGGTGGGGAGGCTGGAGGAGG + Intergenic
1124215720 15:27805922-27805944 TTCGGCCTGGAGGCGGGCGGAGG - Intronic
1124278828 15:28346763-28346785 CACGGTGGGGAGGCTGGAGGAGG + Intergenic
1124303871 15:28564845-28564867 CACGGTGGGGAGGCTGGAGGAGG - Intergenic
1124655021 15:31500571-31500593 CTCTGGCGGAGGGCTGGGGGAGG + Intronic
1125541222 15:40471129-40471151 CTCGGGCTGGGGGCGGGAGGAGG - Exonic
1126113356 15:45187911-45187933 CCCGGGCGGGAGCCAGCCGGAGG + Intronic
1127606554 15:60592626-60592648 CCGGGGCGGGAGGCGGGAGGCGG + Intronic
1127686200 15:61347406-61347428 GGCGGGCGGGGGGCTGGCAGAGG + Intergenic
1128309735 15:66622471-66622493 TTAGGGCGGGGGGCTGCCGGGGG - Intronic
1129157962 15:73730667-73730689 CTTGGGCTGGAGGCTGGCGGTGG - Intergenic
1129189225 15:73927718-73927740 CTCGGGCGGCGGGTTGGCGTAGG - Exonic
1129423905 15:75451378-75451400 GCCGGGCGGGAGCCTGGTGGCGG - Intronic
1129460036 15:75695970-75695992 CTGGGGCGGGGGGATGGAGGAGG + Intronic
1129790547 15:78338152-78338174 CTGGGGCAGGAGGCTGGAGGAGG - Intergenic
1129843630 15:78758393-78758415 CAGGGGCGGGAGGCTGGGGAAGG - Intergenic
1130153856 15:81332904-81332926 GTGGGGAGGGAGGCTGGCGGGGG + Exonic
1130258172 15:82335407-82335429 CAGGGGCGGGAGGCTGGAGAAGG + Intergenic
1130411815 15:83654130-83654152 CGCGGGCTGGAGGCCGGCGTCGG + Exonic
1130531064 15:84748369-84748391 CTCGGGCGGGAGGCGGGAGGCGG + Intergenic
1130596757 15:85254553-85254575 CAGGGGCGGGAGGCTGGAGAAGG - Intergenic
1130908695 15:88256834-88256856 CCCGGGCGGGGGGCGGGGGGAGG - Intergenic
1131035145 15:89217219-89217241 CTCGGGGGAGGAGCTGGCGGTGG - Exonic
1131493583 15:92883102-92883124 CGCGGGCGGGAGGCTCGGGCGGG + Intergenic
1131493680 15:92883419-92883441 CGCGGGCGGCAGGTGGGCGGGGG + Intronic
1132518116 16:375291-375313 CCGGGGCGGGGGGCTGGCCGGGG + Intronic
1132713307 16:1278711-1278733 CCCAGCCTGGAGGCTGGCGGGGG + Intergenic
1132765208 16:1531033-1531055 CTCGAGCAGGAGGCTGGCTGTGG - Intronic
1133033160 16:3021179-3021201 CTCGGGTCAGAGGCTGGGGGCGG - Intronic
1133723039 16:8512722-8512744 CTGGGGTGAGAGGCTGGAGGAGG - Intergenic
1133723188 16:8514081-8514103 ATAGGGTGGGAGGCTGGAGGAGG - Intergenic
1134623267 16:15705871-15705893 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1135107558 16:19663527-19663549 ATCGGGGGGGAGGGTGGCGGGGG - Intronic
1135342903 16:21664179-21664201 CACGGGCGGGCGGGTGGCGCAGG - Intergenic
1136087968 16:27899074-27899096 CTCGGGGAGGAGGCTGGCATGGG + Intronic
1136366675 16:29812222-29812244 CTAGGGAGGGAGGGAGGCGGCGG - Exonic
1136376448 16:29868326-29868348 CTCGGGAGGGAGGCTGTGGCAGG + Intergenic
1136517348 16:30775913-30775935 CTCGGGCGTAGGGCCGGCGGCGG + Exonic
1136717144 16:32289921-32289943 CTCGTGCTGGAGGTTGGCTGCGG - Intergenic
1136835518 16:33496175-33496197 CTCGTGCTGGAGGTTGGCTGCGG - Intergenic
1138265230 16:55655832-55655854 CAGGGGCGGGAGGGTGGCGCGGG - Intronic
1138562168 16:57807829-57807851 CTGAGGCGGGAGGATGGCGTGGG + Intronic
1139549036 16:67663389-67663411 CTGGGCAGGGAGGCTGGAGGGGG - Intronic
1141495518 16:84406922-84406944 CCCTGGCTGGAGGCTGGAGGAGG - Intronic
1141665302 16:85462700-85462722 CGCGGGAGGGAGGCGGGAGGCGG + Intergenic
1142291539 16:89195594-89195616 CTGGGGCAGGAGGCGGCCGGGGG + Intergenic
1142295281 16:89217627-89217649 TTCGGCCCGGAGGCTGGAGGCGG + Intergenic
1142379292 16:89722381-89722403 CTCGGGCGCGCGGCTCTCGGCGG - Intronic
1203009285 16_KI270728v1_random:227857-227879 CTCGTGCTGGAGGTTGGCTGCGG + Intergenic
1203145695 16_KI270728v1_random:1796488-1796510 CTCGTGCTGGAGGTTGGCTGCGG - Intergenic
1142591166 17:1006738-1006760 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591186 17:1006803-1006825 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591206 17:1006868-1006890 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591226 17:1006933-1006955 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591246 17:1006998-1007020 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591266 17:1007063-1007085 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591286 17:1007128-1007150 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142737981 17:1913649-1913671 CTCAGGAGGGAGGCTGGGGAGGG + Intergenic
1143373724 17:6455437-6455459 CTCGGGCTTGGGGTTGGCGGCGG + Exonic
1145214461 17:21042037-21042059 CTGGGGCAGGAGGCGGGCTGGGG - Intronic
1146183809 17:30712283-30712305 CTCGGTGGGGAGGGTGGCAGCGG + Intergenic
1147339607 17:39745755-39745777 CTCGTGCCGGAGGCTGGCATGGG - Exonic
1147365728 17:39957900-39957922 TTTGGGCTGGAGGCTGGCAGTGG + Intergenic
1147436203 17:40417742-40417764 CTCGCGGGGGGGACTGGCGGTGG - Intronic
1148081176 17:44968339-44968361 GTCAGGCGGGAGGCTGCAGGCGG - Intergenic
1148107700 17:45128147-45128169 CCAGGGCTGGAGCCTGGCGGGGG + Intronic
1148568457 17:48647466-48647488 CTGGGGCGGGAGGTGGGCGGAGG - Intergenic
1149485522 17:57039792-57039814 CTGGGAGGGGAGGCTGGAGGTGG - Intergenic
1149597889 17:57874842-57874864 TTCGGGCGGGTGGCCGGCGGCGG + Intronic
1149991490 17:61385977-61385999 CTGGGGAGGGAGGCTGGAGAGGG + Intronic
1150240013 17:63623127-63623149 CCCGGGCTGGAGGCTGCCGCAGG + Intronic
1151314048 17:73311200-73311222 GCGGGGCGGGAGCCTGGCGGGGG + Intronic
1151386359 17:73757754-73757776 GTGGGGTGGGAGGCTGGTGGAGG - Intergenic
1151491035 17:74432448-74432470 CCCAGGCGGGGGGCGGGCGGGGG - Intronic
1151956792 17:77384136-77384158 GGCTGGCGGGAGGCTGGCTGGGG + Intronic
1152110052 17:78352958-78352980 CGCGGGCGGGGGCGTGGCGGGGG + Intergenic
1152175167 17:78782368-78782390 CTCGGGCCGGGGGCAGGGGGCGG - Intergenic
1152281958 17:79390101-79390123 CTCGGCCGGGTGGCTGGCTACGG - Intronic
1152349795 17:79778183-79778205 TCCGGGCGGGTGACTGGCGGCGG + Exonic
1152535432 17:80948099-80948121 GCTGGGCGGGAGGCAGGCGGGGG + Intronic
1152695271 17:81741030-81741052 CTGGGGAGGGAGGCTGGGGGAGG - Intergenic
1153886977 18:9475760-9475782 CGCGGGCGCGAGGCCGGCGCGGG - Intronic
1153900539 18:9614332-9614354 GGCGGGGGGGAGGCGGGCGGGGG - Intronic
1155392351 18:25350385-25350407 CGCGGGCGGGCGGGAGGCGGCGG + Intronic
1157072934 18:44431023-44431045 TGCGGGTGGGAGGCTGGGGGAGG - Intergenic
1157236042 18:45966262-45966284 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1157279027 18:46333939-46333961 CGCGGGCGCGCGGGTGGCGGAGG - Intronic
1157384269 18:47248188-47248210 TGCGGCCGAGAGGCTGGCGGCGG + Intronic
1157478778 18:48039817-48039839 TTGGGCAGGGAGGCTGGCGGTGG - Intronic
1158342861 18:56485540-56485562 GTGGGGTGGGAGGCTGGGGGAGG - Intergenic
1158427305 18:57352040-57352062 TTGGGGTGGGAGGATGGCGGGGG + Exonic
1158691990 18:59669210-59669232 CTAGAGGGGAAGGCTGGCGGAGG - Intronic
1159586692 18:70289107-70289129 CTCGGGCGGGAGGCAGGGGCAGG + Intronic
1160204714 18:76822905-76822927 CTGAGGCGGGAGGCGGGAGGCGG + Intronic
1160613611 18:80108179-80108201 TCAGGGCTGGAGGCTGGCGGCGG + Intergenic
1160725434 19:616131-616153 CGCGCCCGGGGGGCTGGCGGGGG - Exonic
1160727676 19:624770-624792 CTGCGGCGGGAGGCTGAAGGTGG + Exonic
1160773901 19:846124-846146 CTGGGGCAGAAGGCAGGCGGCGG - Intronic
1160842870 19:1154300-1154322 CTCGGCCGGGCAGCAGGCGGCGG + Exonic
1160861187 19:1237778-1237800 CATGGGCGGCGGGCTGGCGGCGG + Exonic
1160879467 19:1312961-1312983 GGCGGGTGGGGGGCTGGCGGCGG - Intergenic
1161091286 19:2361183-2361205 CTGGGGTGGGAGGCTGGGGTGGG + Intergenic
1161091301 19:2361214-2361236 CTGGGGTGGGAGGCTGGGGTGGG + Intergenic
1161153560 19:2721368-2721390 CTCGGGCGGGCGGGGGGCGGCGG - Exonic
1161241135 19:3224622-3224644 CGCGGGCGGGAGGAGGGCGCGGG + Intergenic
1162607207 19:11718732-11718754 CTCGGGCGGGAGGCTGAGCCAGG - Intergenic
1162931836 19:13961360-13961382 CTGGGTGGGGAGGCTGGGGGCGG - Exonic
1162935563 19:13979921-13979943 CCAGGGACGGAGGCTGGCGGAGG + Intronic
1162974973 19:14203398-14203420 CTCGGTGGGGAGGGTGGCAGTGG - Intronic
1163121928 19:15223523-15223545 CGCCGGCGGGAGGGAGGCGGGGG - Intergenic
1163561160 19:18020450-18020472 CTGGGAGGAGAGGCTGGCGGTGG - Intergenic
1163722160 19:18903474-18903496 CTAGGGGAGGGGGCTGGCGGGGG - Intronic
1163767748 19:19172665-19172687 CTAGGGTGGGAGGCTGGGGGAGG + Intronic
1165204535 19:34172479-34172501 TGAGGGCGGGAGGCTGGGGGAGG + Intergenic
1165289069 19:34868554-34868576 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
1165797565 19:38527818-38527840 CTCTGGGCGGAGCCTGGCGGGGG + Intronic
1166106579 19:40600834-40600856 CCTGGGCAGGAGGCTGGAGGTGG - Intronic
1166721801 19:45001424-45001446 GCCGGGCGGGCGGCGGGCGGGGG - Exonic
1166813360 19:45527188-45527210 ATGGGGAGGGAGGCTGGAGGGGG - Intergenic
1167048737 19:47066551-47066573 CTCGGGGGGTGGGGTGGCGGTGG + Exonic
1167506385 19:49873171-49873193 CCCGGGCGGGGTGGTGGCGGCGG + Exonic
1167587642 19:50384013-50384035 CCCGGGCGAGAGGCGGGCGGGGG + Intergenic
1168333039 19:55580613-55580635 CTCGGGAGGGAGGCTGGTGGGGG + Intronic
925793510 2:7518229-7518251 CTCGGGAGAGAGGTTGGAGGTGG + Intergenic
926152526 2:10432884-10432906 CTGGGGCAGGAGGCTGGGGAGGG + Intergenic
926436530 2:12844173-12844195 CTGGTGCGGGATGCTGACGGTGG + Intergenic
927610224 2:24531598-24531620 AGGGGGCGGGAGGCTGGTGGAGG - Intronic
929278739 2:40054632-40054654 CTCGGGAGTGGGGCTGGCAGAGG + Intergenic
931057964 2:58494080-58494102 CTGGGGTGGGATGCTGGGGGCGG + Intergenic
932496708 2:72149102-72149124 CCCGGGCGGGCTGCGGGCGGCGG - Intergenic
932771398 2:74502734-74502756 CACGCCCGGGAGGGTGGCGGTGG - Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
933724814 2:85420769-85420791 CTGGGCCCGGAGGCTGACGGTGG - Intronic
935634838 2:105242359-105242381 CACGGGCTGGACGCTGGTGGAGG + Exonic
937268253 2:120630755-120630777 CTGTTGCGGGAGGGTGGCGGGGG + Intergenic
937950838 2:127387344-127387366 GCCGGGAGGGGGGCTGGCGGCGG - Intronic
938727441 2:134120637-134120659 CGCGGGCTGGAGGCGAGCGGCGG + Intronic
939947725 2:148429845-148429867 ATGGGGTGGGGGGCTGGCGGAGG + Intronic
940453747 2:153871887-153871909 CTGGGGTGGGAGGGGGGCGGGGG + Intergenic
940953414 2:159702930-159702952 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
942046643 2:172102796-172102818 CTCTGGCGGGGGGCGGGCAGTGG + Exonic
943081799 2:183265287-183265309 CTCGGGAGGGAGGCTGGGGCAGG + Intergenic
943584132 2:189717936-189717958 CTGGGGTGGGAGGCAGGGGGAGG + Intronic
944154190 2:196593420-196593442 CCCGGGCGGGAGGAAGGTGGCGG - Intronic
944547606 2:200812576-200812598 CTCGGGCGGGAGGCATGGGAAGG + Intronic
945115856 2:206407349-206407371 CTGGGGTGGGAGGCTGGGGGAGG - Intergenic
945189033 2:207166945-207166967 CGCGGGAGGGAGGGCGGCGGCGG - Intronic
945318726 2:208397154-208397176 GTGGGGTGGGAGGCTGGGGGAGG + Intronic
945699421 2:213151736-213151758 CGGCGGCGGGCGGCTGGCGGCGG + Intronic
947119413 2:226799819-226799841 CCCGGGCGGGAGCCTCCCGGCGG - Intergenic
947427093 2:229993852-229993874 CTGAGGCGGGAGAATGGCGGAGG - Intronic
947603546 2:231469122-231469144 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
948505228 2:238423542-238423564 GTGGGGTGGGAGGCTGGAGGTGG + Intergenic
948654717 2:239469406-239469428 CTGGGGCGGGTGGTTGGGGGGGG + Intergenic
948867305 2:240782541-240782563 CAGGTGCGGGAGGCTGGTGGCGG - Intronic
948917034 2:241039634-241039656 CTGGGGCGAGAGGCTGGGTGGGG - Intronic
949026319 2:241768018-241768040 CTCGGGCGGGGGTGTTGCGGTGG + Exonic
1168965107 20:1894290-1894312 CACTGGCGAGAGGCTGGAGGCGG - Exonic
1169782233 20:9322057-9322079 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1170969077 20:21101841-21101863 CAGGGGCCAGAGGCTGGCGGGGG + Intergenic
1171240990 20:23566774-23566796 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1172109403 20:32536474-32536496 CTCGGGCGGGGGGCAGGGGCGGG + Intronic
1172292227 20:33784388-33784410 CAGGGGAGGGAGGCTGGAGGGGG - Intronic
1172792185 20:37513381-37513403 GTGGGGCAGGAGGCTGGCAGAGG + Intronic
1173251672 20:41366908-41366930 CTGGGGCGAGGGGCTGGCGGCGG - Intergenic
1173454132 20:43189905-43189927 CTGAGGCGGGAGGCTGGGCGGGG + Exonic
1174057034 20:47805030-47805052 CTCGGGAGGAAGGCTGAGGGAGG + Intergenic
1175340998 20:58228787-58228809 CTCGGGCGGCAGGCAGGGAGGGG - Intergenic
1175875601 20:62227925-62227947 CCCAGGCGGGAGGCAGGGGGTGG - Intergenic
1176223181 20:63979563-63979585 CTCGGGCGCGGGGCCGGCTGGGG - Exonic
1177902873 21:26938130-26938152 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1178662823 21:34521464-34521486 CTCGGGTGGGAGGGAGGCAGGGG - Intronic
1179209361 21:39312968-39312990 CGGGGGCGGGCGGCGGGCGGCGG + Intronic
1179783839 21:43718960-43718982 TTCGGGCGGCAGAGTGGCGGGGG + Intergenic
1179788110 21:43741147-43741169 CAGGGGCGGGGGGCTCGCGGGGG + Intronic
1179788217 21:43741366-43741388 GGCTGGCGGGGGGCTGGCGGGGG + Intronic
1180177533 21:46097947-46097969 CGAGGGCGGGAGGCTGGAGGAGG - Intergenic
1180320470 22:11315112-11315134 ATGGGGCGGGAGGCTAGGGGAGG + Intergenic
1180615136 22:17121409-17121431 GGAGGGAGGGAGGCTGGCGGCGG + Intergenic
1180742637 22:18064488-18064510 CTGGGGTGGGAGGCGGGCAGAGG + Intergenic
1180866423 22:19122446-19122468 CGCGGGCGGGAGGCGGGGCGGGG - Exonic
1181514389 22:23402724-23402746 CGCGGGCGCGAGGGGGGCGGAGG + Intergenic
1182321786 22:29482439-29482461 CACGAGCGGGTTGCTGGCGGGGG + Intronic
1182355267 22:29719955-29719977 GGCGGGCGGGCGGCTGGCGGGGG + Intergenic
1182469934 22:30542337-30542359 CACTGGCGAGAGGCTGGAGGCGG - Intronic
1183358775 22:37372756-37372778 CAGGGCCGGGGGGCTGGCGGGGG - Exonic
1183482044 22:38070554-38070576 CTGGGGAGGAAGGCTGGCAGGGG - Intronic
1184225796 22:43128262-43128284 GGCGGGCGGCTGGCTGGCGGAGG + Intronic
1184243915 22:43226461-43226483 CTCGGGCTGAGGGCTGGTGGAGG + Intronic
1184265437 22:43343533-43343555 CTGGGGCGGGCGGCAGGTGGGGG + Intergenic
1184276561 22:43412190-43412212 CGCGGGCGGGAGGCCGGGCGCGG + Intronic
1184739771 22:46421179-46421201 CTCGGCAGGGAGGGTGGTGGTGG - Intronic
1185148136 22:49150220-49150242 CTCTGGCTGGAGTCTGGGGGCGG + Intergenic
1185375649 22:50481664-50481686 CTCGGGCGCGAAGCGGGCAGCGG - Exonic
949323346 3:2836765-2836787 CTGGGGTGGGGGGCTGGGGGAGG + Intronic
949517525 3:4821008-4821030 CTCAGTGGGGAGGCTGGTGGGGG - Intronic
949577780 3:5355585-5355607 CTGGGGCGGGGGGCGGGGGGAGG + Intergenic
950478865 3:13232410-13232432 CTCTGGCAGGAGGCTGTCGCAGG + Intergenic
950684537 3:14607049-14607071 CTTGTGCGGGAGGCTGGGTGAGG + Intergenic
950776696 3:15356392-15356414 CTAGCGCTGGAGGCTGGAGGTGG + Intergenic
950905836 3:16537079-16537101 CTGGGGACGGAGGCTGGAGGGGG - Intergenic
952113542 3:30153099-30153121 ATAGGGTGGGAGGCTGGGGGAGG - Intergenic
952880243 3:37980874-37980896 CACAGGCGGGAGGCAGGCAGAGG - Exonic
953030647 3:39177750-39177772 CAGGGGCGGGAGGCGGGAGGCGG - Intergenic
953492740 3:43364439-43364461 GTCGGGCGGGGGGCGGGGGGCGG + Intronic
954391225 3:50269113-50269135 CGAGGGCGGGAGGCTAGGGGGGG - Intronic
954582298 3:51709460-51709482 CTAGGGAGGGAGGCCGGAGGTGG + Intronic
954614205 3:51961210-51961232 CTCGGACGGGGGACTGGAGGAGG - Exonic
954663476 3:52238121-52238143 CTAGGGCTGGGGGCTGGGGGTGG + Intronic
954912709 3:54122462-54122484 GTGGGGAGGGAGGCGGGCGGGGG - Intergenic
955058227 3:55474673-55474695 CTGGGCCGGGATGCTGCCGGGGG + Intronic
955060398 3:55488018-55488040 CGCGGGCGCGAGGCTGGGGAAGG + Intronic
955228455 3:57079344-57079366 CGTGGGCGGGAGGCGGGCCGGGG + Intergenic
956770739 3:72523768-72523790 CTTGGCCGGGAGGGTGGTGGGGG - Intergenic
959591928 3:108091073-108091095 CGCGGGCGGGGAGCAGGCGGGGG - Intergenic
960734055 3:120758564-120758586 CGGGGGTGGGAGGCTGGGGGAGG - Intronic
963159424 3:142135547-142135569 ATGGGGTGGGAGGCTGGGGGAGG - Intronic
963744810 3:149115491-149115513 CTAGGGCAGGAGGCTGGGGAGGG - Intergenic
965302396 3:167019020-167019042 ATGGGGCGGCTGGCTGGCGGGGG - Intergenic
968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG + Exonic
968240140 3:197072802-197072824 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
968358627 3:198130043-198130065 CGGGGGTGGGAGGCTGGGGGAGG - Intergenic
968636973 4:1685507-1685529 CTGGGGCTGGATGCTGGGGGAGG + Intergenic
972533053 4:39977572-39977594 CCCGGGCGGGCGGGCGGCGGCGG - Exonic
976565899 4:86550589-86550611 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
979448505 4:120840768-120840790 CTAGGGCGGCAGGCTGCAGGGGG + Intronic
980035669 4:127880742-127880764 TTCGGGCGGGAGGCTGTCTCGGG - Intergenic
982056359 4:151552674-151552696 GTCGGGTGGGAGGATGGGGGAGG + Intronic
982712171 4:158768855-158768877 CCCCGGCGGGAGGCGGGAGGTGG - Intergenic
983076369 4:163331956-163331978 GTCGGGCTGGGAGCTGGCGGAGG - Intronic
983296625 4:165874844-165874866 CGCGCGCGAGAGGCTGGCAGCGG - Intronic
983409076 4:167373266-167373288 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
984206475 4:176792795-176792817 CGGGGGCGGGAGGAGGGCGGCGG + Intergenic
985794486 5:1952196-1952218 CTGGGGCATGTGGCTGGCGGGGG + Intergenic
986243040 5:5978706-5978728 CACGGGTGGGAGGCTGGGAGTGG - Intergenic
986402803 5:7396097-7396119 CGCGGGCGGGGGCCGGGCGGCGG - Intergenic
987840111 5:23212532-23212554 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
988862787 5:35302025-35302047 CTGAGGCGGGAGGCTGGGGCAGG + Intergenic
991584435 5:68187714-68187736 CTCGGGAGGGAGCGCGGCGGGGG - Intergenic
993655765 5:90576255-90576277 GTGGGGCGGGGGGCTGGGGGAGG - Intronic
997248945 5:132374106-132374128 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
997301959 5:132813236-132813258 CTGGGGCGGGCGGGGGGCGGCGG + Intergenic
997521806 5:134527809-134527831 CTCTTGCTGGAGGCTGGGGGAGG + Intronic
997539415 5:134649111-134649133 CTGGGCCTGGAGGCTGGCTGGGG - Exonic
998018845 5:138753377-138753399 CGCGGGCGGGGGGCGGGCCGGGG + Intronic
998101825 5:139440744-139440766 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
998231445 5:140363716-140363738 CTCGGGCGGGAGGCTGTTTGGGG + Exonic
998583469 5:143403729-143403751 CTCGGGCGGGGAGCGGCCGGGGG - Intronic
999232480 5:150069820-150069842 CAGGGGCGGGGGGCGGGCGGGGG + Intronic
999726975 5:154445854-154445876 CTGGCGCCGGAGACTGGCGGCGG + Intergenic
999781043 5:154850611-154850633 CTCGGGTGGGAGGCTGGCCATGG + Exonic
1000266229 5:159640883-159640905 CGTGGGAGGGAGGCTGGCAGGGG + Intergenic
1000711969 5:164591501-164591523 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1001401933 5:171451065-171451087 CGCGGGCGGGAGGCGGCCGGCGG - Intronic
1001420988 5:171586993-171587015 CTCAGTGGGGAGGCAGGCGGTGG - Intergenic
1002006502 5:176238693-176238715 CAGGGGCGGGAAGCGGGCGGCGG - Intronic
1002183150 5:177441781-177441803 CTCGGGCTGGGGGCTAGAGGCGG - Exonic
1002219876 5:177671943-177671965 CAGGGGCGGGAAGCGGGCGGCGG + Intergenic
1002296149 5:178232466-178232488 CCCGGGCGGGGGGCGGGCGGCGG - Intronic
1002524409 5:179807158-179807180 CCGGGGCGGGGGGCGGGCGGCGG + Intronic
1002925796 6:1605062-1605084 CTCGGAAGGAAGGCTGGCTGCGG + Intergenic
1003673637 6:8182447-8182469 CTGGTGCGGGAAGCTGGAGGGGG + Intergenic
1004650132 6:17600446-17600468 CCCGGGCAGGACGATGGCGGAGG + Exonic
1005414179 6:25583825-25583847 GTTGGGCGGGAGGCGGGTGGGGG - Intronic
1005781896 6:29201400-29201422 CAAGGGAGGGAGGCTGGAGGGGG + Intergenic
1005913025 6:30327115-30327137 CCCGGGCCCGAGGCGGGCGGAGG - Intronic
1006187728 6:32190219-32190241 CGAGGGAGGGAGGCTGGGGGAGG + Intergenic
1006679461 6:35786945-35786967 CGAGGGCGGAAGGCGGGCGGTGG + Intronic
1006861059 6:37171554-37171576 CTGGCGCGGGAGACTGGCCGAGG - Intronic
1007072703 6:39048758-39048780 CCCGGGCTGGTGGCGGGCGGTGG - Intergenic
1007553281 6:42746290-42746312 GTGGGGTGGGAGGCAGGCGGGGG + Intergenic
1008106332 6:47444044-47444066 CCCGGACGGGCGGCTGGCTGGGG + Intergenic
1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG + Intergenic
1013213079 6:108003984-108004006 CTAGGTAGGGAGGCTGGGGGTGG - Intergenic
1014913713 6:127120506-127120528 CCCGGGCGGGACGCTGGGAGAGG - Intronic
1014986817 6:128021526-128021548 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1015137132 6:129885604-129885626 ATCGGGTGGGGGGCTGGGGGAGG + Intergenic
1016386835 6:143537299-143537321 CTGGCCCGGCAGGCTGGCGGCGG + Intronic
1016400858 6:143678244-143678266 CGCGGGCGCAGGGCTGGCGGCGG + Intronic
1017406948 6:154129830-154129852 CTGGGGGGGGAGGGTGTCGGTGG - Intronic
1018613282 6:165662842-165662864 CGCGGGCGGGAGGGGCGCGGCGG + Intronic
1018811351 6:167300463-167300485 CTCAGGGGGGAGGCTGGACGAGG + Intronic
1020276928 7:6630210-6630232 CTGGGGCTGGGGGCTGTCGGGGG + Intergenic
1020780064 7:12506640-12506662 ATGGGGTGGGAGGCTGGGGGAGG + Intergenic
1021313096 7:19116739-19116761 CTCGGTCTGGAGGATGGAGGGGG - Exonic
1021436849 7:20628150-20628172 GTGGGGTGGGAGGCTGGGGGAGG - Intronic
1025020490 7:55476127-55476149 CCCGGCTGGGAGGCTGGCTGTGG - Intronic
1025061249 7:55810584-55810606 CTCGGGAGGGAGGCTGAGGCAGG - Intronic
1025193078 7:56911150-56911172 CTTTGGTGAGAGGCTGGCGGGGG + Intergenic
1025678865 7:63665770-63665792 CTTTGGTGAGAGGCTGGCGGGGG - Intergenic
1025979245 7:66393655-66393677 TCCGGGAGGGAGGCGGGCGGGGG - Intronic
1026010037 7:66629212-66629234 CCCGGGCGGGCGGCGGGCCGCGG + Intronic
1026837376 7:73647813-73647835 CAGGGGCGGGCGGCGGGCGGCGG + Intergenic
1026874170 7:73870168-73870190 CTGGGTGGGGAGGCTGGCTGGGG - Intergenic
1026894561 7:74002805-74002827 GTGAGGCAGGAGGCTGGCGGGGG - Intergenic
1027154164 7:75754681-75754703 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1029441091 7:100586902-100586924 CCCGGGCTGGGGGCGGGCGGGGG + Intronic
1029456345 7:100674254-100674276 GGCAGGCGGGAGGGTGGCGGTGG - Intronic
1029813974 7:103075219-103075241 CCAGGGCAGGAGGCTCGCGGGGG - Exonic
1030227545 7:107169408-107169430 CTCGGGCGGGGGCCGGGAGGAGG + Intronic
1030266920 7:107630541-107630563 CTCGGGATGGAGGCTGACGCCGG - Intergenic
1032201533 7:129825864-129825886 CGCGGGCGGGAGTCTGGGTGGGG - Intergenic
1032787414 7:135211656-135211678 CTCGGGCGGGGAGCCGGCCGAGG - Intergenic
1033346846 7:140532155-140532177 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1033477140 7:141702052-141702074 CGCAGGCGGGAGGCTGGGGCCGG - Exonic
1033600927 7:142888005-142888027 CTGGGGAGAGAGGCTGGGGGAGG + Intergenic
1033654410 7:143362929-143362951 CACGGGCGGGAGGAGGGGGGCGG - Intergenic
1034301722 7:150021617-150021639 CTCGGGGGGAAGGCTGGGAGGGG - Intergenic
1034339271 7:150341537-150341559 CTGGGGCGGCAGCCGGGCGGAGG - Exonic
1034615899 7:152416435-152416457 CTCGGGAGGGAGGCTGAGGCAGG + Intronic
1034804324 7:154075650-154075672 CTCGGGGGGAAGGCTGGGAGGGG + Intronic
1035796288 8:2360299-2360321 CTCGGGAGGGAGGCTGAGGCAGG - Intergenic
1039765849 8:40626803-40626825 CTGGGGAGGGGGGCTGGAGGTGG + Intronic
1040415443 8:47190748-47190770 TTCGGGTGGGGGGCTGGGGGAGG - Intergenic
1042185675 8:66134456-66134478 CTGGGGCCAGAGGCTGGAGGGGG + Intronic
1042625054 8:70748541-70748563 CGTGGGAGGGAGGCTGGTGGGGG + Intronic
1044622522 8:94204294-94204316 CTGGGGTGGGAGGCAAGCGGAGG - Intronic
1045305543 8:100953117-100953139 CTCGGGCGGAGGGCTGGAGCTGG + Intronic
1045446687 8:102273133-102273155 AGTGGGCGGGAGGCTGGAGGGGG + Intronic
1045488642 8:102654254-102654276 CACGGCCGGGCGGTTGGCGGCGG - Intronic
1048081976 8:131138297-131138319 CTCGGGAGGGAGGCTGAGGCGGG + Intergenic
1048279734 8:133096262-133096284 CTCTGGCTGGAGGCTCACGGAGG - Exonic
1049357731 8:142196968-142196990 CTCGGCTGGGAGGGTGGAGGCGG - Intergenic
1049583539 8:143423077-143423099 CTGAGGCGGGAGGCTGGCCCAGG - Intronic
1049680313 8:143915249-143915271 CCCGGGCGGGTGGCAGGTGGAGG - Exonic
1049747293 8:144268518-144268540 CTCAGGCTGGGGGCTGGGGGTGG - Intronic
1050639702 9:7654418-7654440 CTGGGGCGGGGGGCTGCTGGCGG - Intergenic
1051406044 9:16738811-16738833 CTGGGGCGGGAGGATGGGGGTGG - Intronic
1052781182 9:32783284-32783306 CTGGGGCGCGAGGCTGCCAGTGG - Intergenic
1053203139 9:36166187-36166209 CGCGGGCGGGAGGGAGGGGGAGG - Intergenic
1053214332 9:36258239-36258261 CTGGGGCAGGAGGCCGGGGGAGG + Intronic
1054738466 9:68780209-68780231 TACGGGCGGGAGCCCGGCGGAGG + Exonic
1055643492 9:78340627-78340649 ATGGGGTGGGAGGCTGGGGGAGG + Intergenic
1056143425 9:83707147-83707169 CCCCGCCCGGAGGCTGGCGGTGG + Intronic
1056592429 9:87974337-87974359 CGCGGCCGGCAGCCTGGCGGGGG - Intronic
1056712060 9:88999237-88999259 CGGGGGCGGGGGGTTGGCGGGGG - Exonic
1056992354 9:91423736-91423758 CCGCGGCGGGAGGCGGGCGGCGG + Exonic
1057466273 9:95317318-95317340 CTGAGGCGGGAGGCGGGAGGCGG - Intronic
1058160834 9:101568854-101568876 CTCGGGCGGGAGGCTGAGGCAGG + Intergenic
1058753315 9:108060561-108060583 CTCGGGGGGCGGGGTGGCGGGGG + Intergenic
1060180389 9:121529703-121529725 CCTGGGCAGGGGGCTGGCGGTGG + Intergenic
1060770117 9:126326650-126326672 CTCGGGCGGGAGGAGGGAGAGGG - Intergenic
1061128274 9:128689939-128689961 CTCGGGAGGGAGGGAGGGGGAGG - Intronic
1061273604 9:129557637-129557659 TTCAGGCTGGAGGCTGGTGGGGG - Intergenic
1061316093 9:129796635-129796657 CGCGGACGGGAGGATGGAGGGGG + Intergenic
1061974035 9:134059435-134059457 CTCGGGCTGGAGGAAGGCAGCGG + Intronic
1061987067 9:134136086-134136108 CTCGGGCGGGCGCCAGGCGGCGG - Exonic
1062022552 9:134326344-134326366 CGCCGGCGGGGGGGTGGCGGGGG - Intronic
1062314621 9:135960748-135960770 CTCGGCCGGGCGGCTGGCACGGG + Intronic
1203368680 Un_KI270442v1:280858-280880 ATGGGGCGGGAGGCTAGGGGAGG + Intergenic
1185621454 X:1453338-1453360 CCCGGGGGGGAGGCGGGCGGGGG - Intronic
1192220985 X:69197206-69197228 CTGAGGCAGGTGGCTGGCGGGGG - Intergenic
1193237812 X:79130573-79130595 CTCGGGAGGGAGGCTGAGGCAGG + Intergenic
1193969966 X:88039130-88039152 GTCGGGCGGGGGGCGGGGGGTGG - Intergenic
1195776157 X:108408202-108408224 CTCGGGAGGGAGGCTGAGGTGGG + Intronic
1196924856 X:120623392-120623414 CTGGGGCGGTGGGCTGGCAGGGG - Intergenic
1197727982 X:129788761-129788783 ACGGGGCAGGAGGCTGGCGGGGG + Intronic
1199826437 X:151505057-151505079 GTGGGGTGGGAGGCTGGGGGAGG - Intergenic
1199901857 X:152181670-152181692 GTGGGGTGGGAGGCTGGGGGAGG + Intronic
1200168000 X:154050561-154050583 CGCGGGGGGGAGGGGGGCGGTGG + Intronic
1200218541 X:154379450-154379472 CTCAGGCGGAGGCCTGGCGGCGG - Exonic
1200226312 X:154419768-154419790 CTGGGCCGGGAGGATGGCTGTGG - Intronic
1202033602 Y:20606312-20606334 CACGGGTGGGAGCCTGGGGGAGG + Intergenic