ID: 968067533

View in Genome Browser
Species Human (GRCh38)
Location 3:195767000-195767022
Sequence GGTCCGCTTGGTCATGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968067529_968067533 10 Left 968067529 3:195766967-195766989 CCACATCTGATCGCTAGCTGCAA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 968067533 3:195767000-195767022 GGTCCGCTTGGTCATGAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 46
968067528_968067533 16 Left 968067528 3:195766961-195766983 CCGATTCCACATCTGATCGCTAG 0: 1
1: 0
2: 0
3: 1
4: 55
Right 968067533 3:195767000-195767022 GGTCCGCTTGGTCATGAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968067533 Original CRISPR GGTCCGCTTGGTCATGAGAC AGG Intronic
901649406 1:10735010-10735032 GGTCCCGTTGGTCATGGGGCGGG - Intronic
905971152 1:42143522-42143544 GGTAGGCTTAGTCATGTGACTGG - Intergenic
909324064 1:74326747-74326769 ACTGAGCTTGGTCATGAGACTGG + Intronic
910217042 1:84853398-84853420 GGTCAGCTGGGGAATGAGACAGG + Intronic
911720908 1:101190218-101190240 GGCCCGGTAGGTCAGGAGACAGG + Intergenic
912676170 1:111682802-111682824 GGTCCGCTTGGTCCAGAGCTGGG - Intronic
916406796 1:164506064-164506086 GTTCGGCTTGGTCCTGAAACAGG - Intergenic
916793619 1:168146010-168146032 GGTCCACCTGGTCTTGGGACTGG - Intergenic
1064975346 10:21108675-21108697 GGTCCGCTTGGTCCAGAGCTGGG + Intronic
1067293549 10:44961332-44961354 GGTCCACTTGGTCCTGACCCAGG - Intronic
1085294877 11:75425692-75425714 GGTCAGTTTGGTCCTGAAACTGG - Intronic
1096840317 12:54375886-54375908 GGGCCGCTTGGTCTTGAGCAAGG + Exonic
1102792966 12:115663121-115663143 GTTCCACATTGTCATGAGACAGG + Intergenic
1105015524 12:132784326-132784348 CGGGCGCTTGGTCATGGGACAGG + Intronic
1114741009 14:25097298-25097320 GGTCAGCTCAGTCGTGAGACAGG - Intergenic
1125756632 15:42069670-42069692 GGTCCCCTTTGTCATGATGCCGG - Intronic
1136289058 16:29260690-29260712 GGGCCGCCTGGGCATGAAACAGG + Intergenic
1138473920 16:57259429-57259451 GGTCCTCTTGGTCCTGACCCTGG - Intronic
1142094789 16:88233617-88233639 GGGCCGCCTGGGCATGAAACAGG + Intergenic
1142319358 16:89371039-89371061 AGTCCCCTTCGTCATGAGACGGG - Intronic
1161671353 19:5612826-5612848 GGTCAGCTTGGTCATGGGGTGGG - Intronic
1164571787 19:29379993-29380015 GGTCCGCATGGAATTGAGACAGG + Intergenic
1164809681 19:31146433-31146455 GGGCAGCTTGGACATCAGACAGG - Intergenic
926906467 2:17810364-17810386 GGTCCTATTTCTCATGAGACAGG + Intergenic
944373430 2:199012052-199012074 GGTCAGCCTGGCCATGGGACAGG + Intergenic
948278006 2:236724889-236724911 GGACAGCTTGGCAATGAGACTGG + Intergenic
1180181969 21:46122065-46122087 GGTCAGCATGGTCATAGGACGGG - Intronic
1184895892 22:47406257-47406279 GGTCCCCTTGGTCAAGAGGGGGG - Intergenic
968067533 3:195767000-195767022 GGTCCGCTTGGTCATGAGACAGG + Intronic
973579550 4:52328907-52328929 GGTCCGTTTGGTCTAGAGTCTGG + Intergenic
980797284 4:137700911-137700933 ATTCCTCTTGGTCATGGGACAGG + Intergenic
982848497 4:160280212-160280234 GGTCCGCTTGGTCCAGAGCTGGG - Intergenic
982892870 4:160877685-160877707 ATTCCTGTTGGTCATGAGACAGG + Intergenic
999716712 5:154366933-154366955 GGCCCACTTGATCCTGAGACAGG - Intronic
1002517074 5:179766561-179766583 AGTCCGCTTTGTAATGAGAAAGG - Exonic
1007730764 6:43944200-43944222 AGTCTGCTTGGCCAGGAGACAGG + Intergenic
1018807911 6:167275526-167275548 GGAACTCTTGGTCATGAGAGTGG + Intronic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1028142139 7:87286148-87286170 GGTCTGCTTGGTCAAGAGCTGGG + Intergenic
1028151694 7:87381027-87381049 GCTCCGCTGGGCCATGATACAGG + Intronic
1030245430 7:107379904-107379926 GGTCCGCTTGGTCCAGAGCAGGG - Intronic
1034264821 7:149775860-149775882 GGTGCCCTGGGGCATGAGACTGG + Intergenic
1039283242 8:36009078-36009100 GGTCCGCTTGGTCCAGAGCCAGG - Intergenic
1043335346 8:79169676-79169698 TGTGCGCTTGGCCATGAGGCAGG - Intergenic
1047426190 8:124749046-124749068 GTTCTGCTTGGCCATGATACAGG + Intergenic
1050767395 9:9151683-9151705 GCTCCGGTTGTTGATGAGACAGG + Intronic
1051734763 9:20187072-20187094 GCTCTGCTGGCTCATGAGACAGG - Intergenic
1057424966 9:94940888-94940910 GTTCTGGTTGGTCAAGAGACAGG - Intronic
1190331329 X:49237227-49237249 GTTCCGCCTGGCCATGAGCCTGG + Exonic