ID: 968067889

View in Genome Browser
Species Human (GRCh38)
Location 3:195768936-195768958
Sequence CTGCACACACACTCCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 312}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968067889 Original CRISPR CTGCACACACACTCCCATCC TGG (reversed) Intronic
900031105 1:373757-373779 CTGCAGAGACAGGCCCATCCTGG + Intergenic
900051674 1:602011-602033 CTGCAGAGACAGGCCCATCCTGG + Intergenic
900215526 1:1479598-1479620 CTGCACATACACCCCCACACAGG + Intronic
900215584 1:1479864-1479886 CTGCACACACACCCCCACACGGG + Intronic
901846517 1:11986406-11986428 GTGCACACACCCCCTCATCCAGG + Intronic
901876460 1:12169545-12169567 CTGCACTCATGCTCCCAGCCAGG + Intronic
901880135 1:12188931-12188953 CTGTACACACACGCTCCTCCAGG - Intronic
902701010 1:18172006-18172028 CTGCAGACACAATCCTGTCCAGG - Intronic
903000373 1:20261230-20261252 CAGCACACAGGCTCCCTTCCTGG - Intergenic
907588896 1:55646886-55646908 CTGCATGCACACTCCAATCCAGG - Intergenic
907936895 1:59049501-59049523 ATGCACACACATTCCCTTCTCGG - Intergenic
908929778 1:69304654-69304676 CTGCACAAACCCTCCAATGCTGG - Intergenic
909869555 1:80722617-80722639 CAGCAGACACACTCCCAGGCCGG - Intergenic
909871627 1:80746894-80746916 ATGCACACACACTCCTTTGCTGG - Intergenic
911040005 1:93583878-93583900 CTGCAAACCCATTCCCCTCCAGG + Intronic
911180291 1:94854550-94854572 CTGCATTCACACAGCCATCCAGG + Intronic
912171153 1:107101065-107101087 ATGTACCCACACTCCCATCCTGG - Intergenic
912810815 1:112793124-112793146 CTGAACACCCCCTCCCATCATGG + Intergenic
915091852 1:153431964-153431986 CTGCACACACAGTTTCATTCTGG - Intergenic
915107746 1:153544957-153544979 CTGTGCACACCCTCCCAGCCAGG - Intronic
915300393 1:154948214-154948236 CTGCACCCTCACCCCCAGCCTGG + Exonic
915590399 1:156867184-156867206 CAGCACACACACAGTCATCCAGG - Intronic
918790953 1:188828101-188828123 CTCTACACCCACTCCCAACCTGG + Intergenic
919645442 1:200090074-200090096 TTGCACACTCACTCCTAGCCTGG + Intronic
920204252 1:204280354-204280376 ATGCACACACACTCCCAGGCTGG + Intronic
923165075 1:231353073-231353095 CTTCAGACCCACTCACATCCTGG - Exonic
1062956980 10:1546907-1546929 CTTCACAGACCCTCCCTTCCTGG - Intronic
1063374990 10:5548963-5548985 GTGCACACACACACGCCTCCTGG + Intergenic
1065138211 10:22693694-22693716 CTTAACACACACACCCAGCCTGG + Intronic
1065718626 10:28601898-28601920 CTTAACACCCACTCCCACCCCGG - Intronic
1066330384 10:34415233-34415255 TTGCACAAACACTCCCACCCTGG + Intronic
1067286485 10:44911243-44911265 CTGCTCACACAACCCCAGCCTGG - Exonic
1067344798 10:45429281-45429303 CTGCACACCAGCTCCCAGCCTGG - Intronic
1067538571 10:47135402-47135424 CTGCACTCAGGCTGCCATCCTGG + Intergenic
1070166855 10:73905470-73905492 CTGCACACACACCTGCCTCCAGG + Intergenic
1070694699 10:78553125-78553147 CTGCAAACACACTCCCTGCTTGG + Intergenic
1070948635 10:80413314-80413336 CTCAACCCACACTCCCTTCCTGG - Intronic
1071471269 10:85985643-85985665 CTGCACTCACAGTCACCTCCTGG + Intronic
1074146811 10:110724162-110724184 CTGCACACACACTGGCAGACGGG - Intronic
1075091790 10:119447939-119447961 GTGCTCACACACTCACAGCCTGG - Intronic
1075297190 10:121288062-121288084 ATACACACACACACCCATCCAGG + Intergenic
1075719786 10:124577936-124577958 CAGCACACACAGCCCCATCCTGG + Intronic
1076193901 10:128501291-128501313 ATGCACACACACTCACACACAGG - Intergenic
1076674070 10:132138792-132138814 CTGCTCACACTCACCCATCCTGG + Intronic
1077160412 11:1110035-1110057 CTCCAGGCACACTCCCAGCCTGG - Intergenic
1077237281 11:1487827-1487849 CTGCACGCACACACACAGCCTGG + Intronic
1077312241 11:1894099-1894121 ACACACACACACTCCCAGCCCGG - Intergenic
1078022241 11:7665612-7665634 CTGCACACCCACCCTCAGCCAGG + Intronic
1079056367 11:17209301-17209323 ATGCACACACACTTCCAGGCAGG + Intronic
1079316845 11:19415362-19415384 CTGAACACATACACCCTTCCAGG + Intronic
1080031744 11:27668678-27668700 CTGGACACACACACCCTCCCAGG + Intronic
1080037952 11:27729022-27729044 CTGCACACTCAGGCCCATTCTGG - Intergenic
1080743291 11:35085041-35085063 CTTCTCACCCACTCCTATCCAGG + Intergenic
1082117719 11:48345696-48345718 CTGCACAGACACTCACACCTTGG - Intergenic
1082641390 11:55665724-55665746 CTGCACGGACACCCACATCCTGG + Exonic
1083098400 11:60277422-60277444 CTGTATACACTCTCCCTTCCTGG - Intergenic
1083213544 11:61204263-61204285 TTGCCCGCACACTCACATCCAGG - Exonic
1083216427 11:61223099-61223121 TTGCCCGCACACTCACATCCAGG - Exonic
1083219309 11:61241925-61241947 TTGCCCGCACACTCACATCCAGG - Exonic
1083536904 11:63477930-63477952 CTGCATACACATTCACATTCAGG - Intronic
1083628981 11:64086134-64086156 CTGCGCACACACAGCCATTCAGG + Intronic
1084522073 11:69669628-69669650 CTGCTCAGACACACCCAGCCGGG + Intronic
1084532699 11:69738206-69738228 CTGCACACACCTTCACATACAGG + Intergenic
1085047427 11:73361920-73361942 CCACACACACACACCCATGCAGG + Intronic
1087565254 11:99847769-99847791 TAGCACCCAAACTCCCATCCAGG - Intronic
1088723715 11:112616693-112616715 CTGCATACACACTCACGCCCTGG - Intergenic
1089216603 11:116837910-116837932 CTGCCCACACACTCCCATGGAGG - Exonic
1090680069 11:129046108-129046130 CCGTATACACACTCCCATCATGG + Intronic
1091935830 12:4433903-4433925 ATGCACACAAACTCCTACCCTGG + Intronic
1094055930 12:26269636-26269658 CAGCACACCCACTCACTTCCCGG - Intronic
1096520316 12:52181229-52181251 CTCCACACCCACTCCCCTCCAGG + Intronic
1096736587 12:53660297-53660319 GTGCACACACACACACATACAGG + Intronic
1096849538 12:54426873-54426895 CTGCCCTCCCACTCCCACCCCGG + Intergenic
1096911630 12:54990042-54990064 CTGCACTTACACCCACATCCAGG - Intergenic
1101849897 12:108393613-108393635 CAGCCCACACAGTCACATCCGGG + Intergenic
1102680094 12:114685251-114685273 CTACACCCACACCCACATCCAGG - Intergenic
1103558365 12:121779311-121779333 CTGACCACAAACTCCCCTCCAGG - Exonic
1103832731 12:123793205-123793227 ATGCACACTGACTCCCTTCCTGG + Intronic
1103870204 12:124085796-124085818 CTGCACTCACTCTCTCATCTCGG + Intronic
1103954803 12:124569962-124569984 CTGCACACAAACAGCCTTCCCGG + Intergenic
1104710092 12:130979647-130979669 CTGCACCCACCGTCCCATCATGG + Intronic
1104912413 12:132245639-132245661 CAGCACCCACACCCCCAGCCCGG + Intronic
1110298790 13:73900830-73900852 CTCCACACACATTCTCATCAGGG + Intronic
1112457764 13:99577312-99577334 CTGAACACAGGCTCCCACCCAGG - Intergenic
1112903673 13:104391054-104391076 ATGCACATACAATCCAATCCTGG - Intergenic
1113398934 13:109973955-109973977 CTGTTCACACACACCCCTCCTGG + Intergenic
1114148135 14:20002608-20002630 GTGCACAAATCCTCCCATCCAGG - Intergenic
1114369600 14:22071235-22071257 CTGTACACAAACCCTCATCCGGG + Intergenic
1115430204 14:33308608-33308630 GTGCACACACACACCCCTTCAGG + Intronic
1115478970 14:33843238-33843260 GTGCGCACACACACCCATACAGG - Intergenic
1116064813 14:39969688-39969710 CTGCAGACACACTACCAGGCTGG + Intergenic
1117902649 14:60551101-60551123 CTGCACACCCTCTCCCAAGCAGG - Intergenic
1119476767 14:74934949-74934971 CTGCCCCCACACACCCAGCCTGG - Intergenic
1120254794 14:82105541-82105563 CTGCACAGGGACCCCCATCCAGG - Intergenic
1122058564 14:99121669-99121691 CTCCACACCCACTCACCTCCAGG + Intergenic
1122319725 14:100846677-100846699 GTGTACACACACTCTCATCCTGG - Intergenic
1122848578 14:104514257-104514279 CCACACACACACGCCCCTCCAGG + Intronic
1122856689 14:104563496-104563518 CTGCACACCCACCCTGATCCAGG + Intronic
1123067920 14:105627536-105627558 ATGGACTCACACTCCCTTCCCGG + Intergenic
1123091600 14:105744537-105744559 ATGGACTCACACTCCCTTCCCGG + Intergenic
1123097369 14:105772878-105772900 ATGGACTCACACTCCCTTCCCGG + Intergenic
1123486858 15:20748417-20748439 CTGCACACACACACACCTCCAGG + Intergenic
1123543346 15:21317473-21317495 GTGCACACACACACACCTCCAGG + Intergenic
1124220342 15:27845658-27845680 CCCCACACACACTCACACCCAGG + Intronic
1124903612 15:33847545-33847567 GTGCACACACACTCCAAACATGG - Intronic
1125883090 15:43210057-43210079 CCCCACACCCAGTCCCATCCTGG - Intronic
1126333895 15:47565301-47565323 CTGCACACTCCCTCCCATGAGGG + Intronic
1127391177 15:58506202-58506224 CTGCACAGCCTCTCCCCTCCTGG - Intronic
1129182953 15:73888408-73888430 CTGCTCCCACACTCCCATGCAGG + Exonic
1129670782 15:77606600-77606622 CTGCATACCTCCTCCCATCCAGG + Intergenic
1129900663 15:79145945-79145967 GTGCACACACACTGCTTTCCTGG - Intergenic
1130167106 15:81472764-81472786 ACGCACACACACACGCATCCTGG - Intergenic
1130673346 15:85931678-85931700 CAGCACACAGACTCACAGCCTGG - Intergenic
1202951666 15_KI270727v1_random:44600-44622 CTGCACACACACACACCTCCAGG + Intergenic
1132602767 16:781379-781401 CTGCACCCAAACCCCCTTCCTGG - Intronic
1133304216 16:4799828-4799850 CAGCACCCACTCTCCCCTCCTGG - Intronic
1133923150 16:10172584-10172606 CTGCCCTCCCACTGCCATCCTGG - Intronic
1134379827 16:13713510-13713532 ATGCACACACACACACATGCAGG + Intergenic
1136028005 16:27482245-27482267 CTGCCGCCACACTCCCCTCCAGG - Intronic
1137518062 16:49167305-49167327 CTCCTCAAACACTCCAATCCTGG - Intergenic
1138263002 16:55639085-55639107 CTTCTCACACTCTCCCCTCCTGG + Intergenic
1138414351 16:56862872-56862894 CTGCACACACTCCCCTATCTTGG - Intergenic
1139341567 16:66271005-66271027 CAGCTCACACCTTCCCATCCTGG + Intergenic
1139513326 16:67439543-67439565 CTGCCCACAGCCTCCCACCCAGG + Intronic
1141673147 16:85503312-85503334 CTGCCCACACCCTTCCCTCCTGG - Intergenic
1142863579 17:2777495-2777517 CGGCACCCCCACACCCATCCAGG - Intronic
1143152750 17:4817340-4817362 CTGCCCACACTCTCCTTTCCTGG + Intronic
1145903783 17:28505622-28505644 ATGCAGACACACGCCCACCCAGG + Intronic
1146453209 17:32991000-32991022 CTGCACATGCACCACCATCCTGG + Intronic
1146453234 17:32991100-32991122 CTGCACACCCACCACCATCCTGG + Intronic
1147316260 17:39621880-39621902 CCTTACACACACTCCAATCCCGG - Intergenic
1147424858 17:40341700-40341722 CTTAACACACACCCCCACCCAGG - Intronic
1147587147 17:41659149-41659171 CCCCACACCCACTCCCACCCAGG + Intergenic
1148240936 17:45998954-45998976 CAGCACCCAGACTGCCATCCAGG + Intronic
1150482847 17:65523936-65523958 TTTCACACAAACTGCCATCCTGG + Intergenic
1150601204 17:66652584-66652606 CTGCACACACGCTCTCTTCTTGG - Intronic
1151625460 17:75272783-75272805 CTGCAGACACACCACCACCCAGG - Intergenic
1152467376 17:80473952-80473974 GTGCCCACACACTTCCCTCCAGG + Intronic
1152948536 17:83211912-83211934 CTGCAGAGACAGGCCCATCCTGG - Intergenic
1156191801 18:34728901-34728923 CTGTACACACACCCCAAGCCAGG - Intronic
1157860623 18:51137424-51137446 CTGCACCCAGCCTCCCCTCCTGG - Intergenic
1159206802 18:65264216-65264238 TTGCACACACACACTCACCCTGG + Intergenic
1159946622 18:74448612-74448634 GTGCACACACACTTCCCTCTTGG - Intronic
1160273807 18:77411629-77411651 CTGCCCACACACCCACATCCAGG + Intergenic
1160766547 19:811177-811199 CTGCAGCCACACACCCACCCGGG + Exonic
1161324767 19:3658304-3658326 CTGCACCATCACTCCCAGCCAGG - Intronic
1161490649 19:4559430-4559452 GTGGAGACACTCTCCCATCCAGG + Intronic
1161587089 19:5111394-5111416 CCGCACAGACCCTCCCAGCCAGG + Intronic
1161802953 19:6425925-6425947 CTGGACACAAATTCCCATTCAGG + Intergenic
1162402269 19:10453381-10453403 CTGCACACACAAGCCCACACCGG - Intronic
1162916219 19:13875906-13875928 CTGAGCACACCCTCCCCTCCTGG + Intronic
1163321446 19:16577223-16577245 CTGCATGCCCACTGCCATCCAGG + Exonic
1164237737 19:23351840-23351862 CTGAACACACACCCCCATACAGG + Intronic
1164753413 19:30672232-30672254 CTGCACACACAGACTCCTCCAGG - Intronic
1165246296 19:34500293-34500315 CTCCACACCCACACCCACCCCGG - Exonic
1166269614 19:41705892-41705914 CTTCACACTTAGTCCCATCCTGG - Intronic
1167082153 19:47283822-47283844 ATGCACAGACACACTCATCCAGG - Intergenic
1167312166 19:48743348-48743370 CTGCCCCCACACCCCCATCTAGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926836697 2:17031384-17031406 CTCCACACACACTCCCCACTGGG - Intergenic
927249191 2:20982782-20982804 CTGCACGCACATTCCCTTCTGGG + Intergenic
927497990 2:23563480-23563502 ATGCACACACACACGCATGCAGG - Intronic
928170713 2:29001282-29001304 CTGCACACTCGCTCCCCTCCTGG - Intronic
928432606 2:31233516-31233538 CTGAACAGACTCTCCCTTCCAGG - Intronic
928460459 2:31467649-31467671 CAGCCCACACACACCCAGCCTGG + Intergenic
929037561 2:37709084-37709106 ATGCACACACACTGACATGCGGG - Intronic
931254975 2:60562853-60562875 CTCCACACCCACTTCCATCAGGG + Intergenic
931390441 2:61838369-61838391 GTGCACACACACTCACCTCATGG - Intronic
932472541 2:71970622-71970644 TTACACACAGACACCCATCCAGG + Intergenic
934523464 2:95034205-95034227 CTGCACAGACACCACCTTCCTGG + Intronic
937210798 2:120268560-120268582 CCCCACACACACTCCCGTCCTGG - Intronic
937500917 2:122477831-122477853 CTGCTCAGACCCTCCCATCTTGG + Intergenic
938099655 2:128490029-128490051 CTGCACATACATACACATCCAGG + Intergenic
938378928 2:130825860-130825882 CTGCACACAAAAGCCCATTCTGG + Intergenic
938467541 2:131533210-131533232 CTCCCCACACACTCCACTCCCGG + Intronic
938568712 2:132543002-132543024 CTGAACACCCACCCCCATACTGG - Intronic
938620090 2:133042362-133042384 CTGCATACATCCTCCCACCCAGG - Intronic
939003699 2:136763623-136763645 CTGCACACACACCCCCATATGGG - Intergenic
940394697 2:153174349-153174371 CAGCATAAACACTGCCATCCTGG - Intergenic
944102013 2:196036945-196036967 CAGCACCCACACACCCCTCCTGG + Intronic
944260806 2:197674240-197674262 CAGCAAACAAACTCCCTTCCAGG - Intronic
946322886 2:218963703-218963725 CTGCACACACACACCCCTCCAGG + Intergenic
946409834 2:219510462-219510484 CTGCACACCCACTCCCACGATGG + Intergenic
946718068 2:222574425-222574447 CTGGACACATAGACCCATCCAGG + Intronic
946865755 2:224039580-224039602 CACCTCACACACCCCCATCCGGG - Intergenic
946903739 2:224396449-224396471 CTGCACACACGCCTCCATCCTGG + Intronic
947288289 2:228542866-228542888 CTGCAGACACACTGGCCTCCAGG + Intergenic
947433405 2:230050984-230051006 CTTCATACAGACTCCCATCCCGG + Intronic
1170479633 20:16753188-16753210 CTGCCCACAAACTCTCACCCTGG - Intronic
1170538095 20:17361824-17361846 GAGCACACACACTCTCATGCAGG - Intronic
1170702785 20:18718699-18718721 ATGCACACACACACCCCTCTAGG + Intronic
1171237742 20:23541321-23541343 CTGCACAGACAGTCCTACCCAGG - Intergenic
1171422199 20:25024834-25024856 CAGCACACACAGCACCATCCGGG + Intronic
1172669406 20:36624377-36624399 CTGTACTCACACTCACACCCTGG + Intronic
1172883218 20:38215048-38215070 CTGCACACACGCTCCCCACCAGG + Intronic
1173567714 20:44053650-44053672 ATGCACACACACTCCAAACTTGG + Intronic
1174123302 20:48283589-48283611 CTGTCCACTCACGCCCATCCGGG + Intergenic
1175266725 20:57708027-57708049 CTCCACACTCCCTCCCAGCCTGG - Intronic
1175304490 20:57966551-57966573 CTGCACCCCCACTCCCAGCACGG + Intergenic
1175389949 20:58620732-58620754 GTGCACACACATTCACATGCAGG + Intergenic
1175937951 20:62523551-62523573 CTGCACTCACACTCCCAGGAGGG - Intergenic
1176373183 21:6074648-6074670 CTGCAGACACAGCCCCCTCCTGG - Intergenic
1177399694 21:20586903-20586925 ATACACACACACACCCCTCCTGG - Intergenic
1178234096 21:30821813-30821835 CAGCCCACACAGTCACATCCAGG + Intergenic
1179750294 21:43463595-43463617 CTGCAGACACAGCCCCCTCCTGG + Intergenic
1180019609 21:45113599-45113621 CTGTACAGACACTCCCTTTCAGG - Intronic
1180220172 21:46353585-46353607 ATGCACACACACACACATGCTGG - Intronic
1180934988 22:19619589-19619611 TTGCACACACACTCACCTCAGGG + Intergenic
1181041868 22:20196128-20196150 ATGCAAACACAAACCCATCCAGG - Intergenic
1181514468 22:23403007-23403029 CTGCCTACCCACTCCCTTCCTGG + Intergenic
1182741333 22:32570153-32570175 CTCCACACACACTGCCTTCTAGG + Intronic
1183026358 22:35068398-35068420 CTGCAGACACACAGCCCTCCTGG - Intronic
1183477493 22:38043477-38043499 ATGCACACACACTCCCATTGGGG + Intergenic
1183507038 22:38214992-38215014 GTGCACACACATTCCCTTCGTGG + Exonic
1183705699 22:39473856-39473878 CTGCCCACACACCTCCATCCAGG - Intronic
1183832514 22:40425896-40425918 CTCCACTCACAGTCACATCCTGG + Intronic
1185125302 22:49007190-49007212 CTGCACTCACAGTCCCCTCATGG - Intergenic
950073969 3:10174077-10174099 ATCCACACACACTCCCATCTTGG - Intronic
958765444 3:98361570-98361592 CTCCACACACACTCCTCTCAAGG - Intergenic
960094297 3:113673759-113673781 CTGCACACGCACACCCGTACTGG - Intronic
960203169 3:114862669-114862691 CTGAACCCTCACTACCATCCAGG - Intronic
961109217 3:124269283-124269305 CTGCTCCCTCACCCCCATCCCGG - Intronic
962313485 3:134342544-134342566 CTGCACACACACACGAACCCGGG + Intergenic
962410979 3:135141642-135141664 CTAGGCACTCACTCCCATCCAGG - Intronic
963019289 3:140857038-140857060 CAGCACATGCACTCCCAGCCTGG - Intergenic
966526143 3:180921291-180921313 CTCCACACACACCCCCACCCTGG - Intronic
967808660 3:193736867-193736889 CTGCACATACACTCTCCTGCGGG + Intergenic
968067889 3:195768936-195768958 CTGCACACACACTCCCATCCTGG - Intronic
968605754 4:1534531-1534553 CCGCAGACACACTCCCACCCAGG - Intergenic
970581586 4:17478386-17478408 CTGCAAAAACCTTCCCATCCTGG + Intronic
973159075 4:46993567-46993589 GTGCACACACACGCCCACCGCGG - Exonic
973573231 4:52261402-52261424 CTGCCCTCAAAATCCCATCCTGG + Intergenic
974142714 4:57908337-57908359 CCACACCCACCCTCCCATCCTGG - Intergenic
975083304 4:70306527-70306549 CTCCACCACCACTCCCATCCTGG - Intergenic
976813884 4:89124571-89124593 CTGCTCACTCACCCCAATCCAGG + Intergenic
977332110 4:95650370-95650392 CTGTATGCACACTGCCATCCTGG + Intergenic
979243100 4:118466733-118466755 ACACACACACACTCACATCCTGG + Intergenic
979441423 4:120754704-120754726 CTTCTCACACACTCAGATCCTGG + Intronic
980977184 4:139622692-139622714 ATGGACACAAACTCCCTTCCTGG - Intergenic
983468359 4:168123985-168124007 TTGCACAGCCACTCCCATTCAGG + Intronic
983607634 4:169607952-169607974 CTCCACCCCCACCCCCATCCCGG - Intronic
983885482 4:172975776-172975798 GAGCACACACACACCCAGCCAGG + Intronic
983932638 4:173469910-173469932 CTACACACACACTCAGAGCCTGG - Intergenic
986019280 5:3786083-3786105 CCACACTCACACTCACATCCGGG + Intergenic
987280441 5:16408273-16408295 CTGCACCCTGCCTCCCATCCTGG + Intergenic
988600200 5:32632528-32632550 GGGCACACAAGCTCCCATCCCGG - Intergenic
989669210 5:43894762-43894784 GTGCACACACCCACCCATCCTGG + Intergenic
990339100 5:54804832-54804854 CCTCACACACACCCCCATCACGG + Intergenic
990731325 5:58812151-58812173 CTGAACACACAGTCACATCCAGG - Intronic
991724869 5:69526142-69526164 CAGCCCACTCACTCCCACCCTGG + Intronic
993454515 5:88112265-88112287 TTGCACACCCACACCCTTCCTGG - Intergenic
994171565 5:96663197-96663219 CTTCCAACACACTCCCTTCCGGG - Intronic
999247357 5:150162261-150162283 CTGCTCTCACACACCCAGCCAGG - Intergenic
1001379248 5:171292567-171292589 CTGCACACACCATCCCTTACTGG - Intronic
1002095416 5:176828083-176828105 CTCCACACCCACCCCCAGCCAGG + Intronic
1002101447 5:176860084-176860106 CTGCCCCCACACGCCCAGCCAGG + Intronic
1002181223 5:177432095-177432117 CTGCACTCACCACCCCATCCAGG - Exonic
1002635900 5:180608653-180608675 GGGCACACACACTCTCCTCCAGG - Intronic
1002742715 5:181445111-181445133 CTGCAGAGACAGGCCCATCCTGG - Intergenic
1003035251 6:2636062-2636084 CTGCACAGACTCTCCCCACCTGG + Intergenic
1004122748 6:12840553-12840575 CTGGACCCACTCTCTCATCCAGG + Intronic
1004722377 6:18278244-18278266 CTGAACACACACACGCATGCAGG - Intergenic
1005659662 6:27983566-27983588 CTGCAGACCCACTGCCACCCTGG + Intergenic
1006171309 6:32095034-32095056 CTGCCCACTCAGTCCCCTCCTGG + Intronic
1006922561 6:37636347-37636369 CTGTACACACCCTCCTATCCAGG + Exonic
1007782760 6:44263782-44263804 CTCCACACACACACCCAATCTGG + Intronic
1008614725 6:53215313-53215335 CTCCACATACACACACATCCAGG - Intergenic
1009435539 6:63614271-63614293 CTGCACTCCCACTCCCACCTGGG - Intergenic
1010063318 6:71650189-71650211 CTGCATAGGCACTCCCTTCCAGG + Intergenic
1011086230 6:83544131-83544153 CTGGACACATACACCCTTCCAGG - Intergenic
1011614895 6:89188839-89188861 TTGCACACACACAGACATCCTGG - Intronic
1012117329 6:95318746-95318768 CTGCCCTCACACTCACAACCAGG + Intergenic
1014004031 6:116396829-116396851 ATGCAACCACACTCCCACCCAGG - Intronic
1014375556 6:120668003-120668025 CTGGACACATACACCCTTCCAGG - Intergenic
1016227224 6:141753113-141753135 ATGCACACACACACCCACACAGG + Intergenic
1017094085 6:150788842-150788864 GTGCACACACACTCACTCCCTGG - Intronic
1019130301 6:169868369-169868391 CTGCTCACACCCTCTCATGCTGG - Intergenic
1019135582 6:169905671-169905693 CAGCACAGACCCTCACATCCTGG - Intergenic
1019247850 6:170720850-170720872 CTGCAGAGACAGGCCCATCCTGG - Intergenic
1019307955 7:344758-344780 CTGCATACACGCTCCCTGCCTGG - Intergenic
1019427875 7:985896-985918 CTGCTCACTCACTCCCATCACGG - Intronic
1019497064 7:1345633-1345655 CTGGACCAACCCTCCCATCCAGG - Intergenic
1020105166 7:5419463-5419485 ATGCACACACACACACATCACGG + Intronic
1023515518 7:40997505-40997527 CTGCACACACACACACCTGCTGG + Intergenic
1024094500 7:45973177-45973199 CTTCACTCACACCCACATCCTGG - Intergenic
1024109448 7:46130593-46130615 CTGCCCACTCACTCCTATGCAGG - Intergenic
1024512608 7:50215441-50215463 CTGCAGACATGCTCCAATCCTGG - Intergenic
1026595036 7:71727269-71727291 CTGCACACACACCCCCACCATGG - Intergenic
1028009952 7:85629653-85629675 CTGCCCACACAGACTCATCCAGG + Intergenic
1028951040 7:96635234-96635256 CCCCACACCCACCCCCATCCTGG - Intronic
1029415740 7:100442109-100442131 CTCCAGACACACACACATCCAGG + Intergenic
1030657517 7:112184271-112184293 CTGCACACACACAGCCACACAGG + Intronic
1031979176 7:128113296-128113318 CTGGACACACAGGCCCACCCAGG - Intergenic
1031984775 7:128156928-128156950 CTGCTCACAGTCTCCCATCCAGG + Intergenic
1032013454 7:128361273-128361295 ACGCACACACACCCCCAGCCCGG + Intronic
1033611082 7:142963704-142963726 CTCCACACCCACCCTCATCCTGG - Intergenic
1033914391 7:146306164-146306186 CTGCACACATACACCCTCCCAGG + Intronic
1035303551 7:157915458-157915480 CGCCACACACACACACATCCAGG + Intronic
1035403782 7:158586111-158586133 CAGCACAGACACTCCCTCCCAGG + Intronic
1035490327 7:159270923-159270945 CTGCACACACACCCCTATGTGGG - Intergenic
1035500267 8:87014-87036 CTGCAGAGACAGGCCCATCCTGG + Intergenic
1036171427 8:6489225-6489247 CTTCATTCACACTCCCTTCCAGG - Intronic
1037555669 8:20019807-20019829 ATGCACACACACGCACATCCTGG - Intergenic
1037814133 8:22102998-22103020 CTGCCGCCACACTCCCCTCCTGG + Exonic
1037886150 8:22597464-22597486 CCCAACACACACTCCCCTCCAGG - Intronic
1040465813 8:47693933-47693955 ATGCTCCCACACTCCCACCCTGG - Intronic
1041519633 8:58740982-58741004 CTGCAAACACACTTCCATTTTGG + Intergenic
1041567491 8:59296464-59296486 GGGCCCACACAATCCCATCCTGG + Intergenic
1045049704 8:98311654-98311676 GTGCACACACACACTCCTCCTGG - Intergenic
1045337497 8:101221753-101221775 GTACACACACACACCCATCTTGG - Intergenic
1048287449 8:133152901-133152923 CGGCACACACACATCCCTCCCGG - Intergenic
1048511895 8:135070467-135070489 CTGCACACTCAGTCCCATGAGGG + Intergenic
1049351143 8:142165456-142165478 CTGCTGACCCACCCCCATCCAGG + Intergenic
1049522749 8:143102688-143102710 CTGCACACACACACCTCTCTGGG - Intergenic
1053291783 9:36884887-36884909 CTGAGCACATACTGCCATCCTGG - Intronic
1056787807 9:89605316-89605338 CTCCAACCACACTCCAATCCCGG - Intronic
1057287762 9:93774223-93774245 CAGCACAGACACTGCCATCTTGG + Intergenic
1057722630 9:97545270-97545292 GTGCACACACTCTCCCATTAGGG - Intronic
1058315270 9:103557254-103557276 CTGAACACACACACCCTACCCGG + Intergenic
1059678680 9:116565534-116565556 CTGCCCACCCATTCCCACCCCGG + Intronic
1060149409 9:121278648-121278670 CAGCACTCACAATCCCAGCCTGG - Intronic
1060941847 9:127546981-127547003 CTTGGCACACACTCCCTTCCCGG - Intronic
1061059541 9:128243585-128243607 CTGCACACTCCATCCCTTCCAGG - Intronic
1061662954 9:132142448-132142470 CTGCTATCACACTTCCATCCCGG - Intergenic
1061822378 9:133235707-133235729 CTGCACACACACCCTCCCCCAGG + Intergenic
1062479770 9:136745896-136745918 CTGGTCACACCCTCCCAGCCTGG + Exonic
1062564771 9:137159277-137159299 CTCCACACACACTCCAGTCCTGG + Intronic
1062681656 9:137785250-137785272 CTGCACACTCATCCCCATTCAGG - Intronic
1203608620 Un_KI270748v1:76329-76351 CTGCAGAGACAGGCCCATCCTGG - Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185736792 X:2501320-2501342 CCCCACACACACCCCCAGCCAGG + Intronic
1186423906 X:9448585-9448607 CTGGACACACACACACATACAGG + Intergenic
1186475392 X:9853210-9853232 CTGCTCACACACGCCTCTCCCGG - Intronic
1189251252 X:39601964-39601986 GTGCGCACACACTCCCACACAGG - Intergenic
1190429628 X:50366734-50366756 CTGCACACACACTCACAGAGTGG - Exonic
1191692222 X:63952387-63952409 CTGAACACACACCCCCAACTGGG + Intergenic
1193067462 X:77275101-77275123 CAGCCAACACACTCCCATCTGGG + Intergenic
1199998635 X:153044404-153044426 CTGCACACACACCCACATACAGG + Intergenic
1200251819 X:154558049-154558071 CTGCACAAACTCTCCCATCCTGG + Intronic
1200265948 X:154646367-154646389 CTGCACAAACTCTCCCATCCTGG - Intergenic
1201319451 Y:12681950-12681972 ATGCATACACACACACATCCTGG - Intergenic
1202390820 Y:24368812-24368834 ACACACACACACTCACATCCTGG + Intergenic
1202479964 Y:25301304-25301326 ACACACACACACTCACATCCTGG - Intergenic