ID: 968072734

View in Genome Browser
Species Human (GRCh38)
Location 3:195796723-195796745
Sequence TCTTAGCCTGCATTTTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 401}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968072734_968072737 13 Left 968072734 3:195796723-195796745 CCACAAAAAAATGCAGGCTAAGA 0: 1
1: 0
2: 2
3: 32
4: 401
Right 968072737 3:195796759-195796781 AAATCAGACATTCAAGGAACAGG 0: 1
1: 0
2: 3
3: 31
4: 376
968072734_968072736 7 Left 968072734 3:195796723-195796745 CCACAAAAAAATGCAGGCTAAGA 0: 1
1: 0
2: 2
3: 32
4: 401
Right 968072736 3:195796753-195796775 ACAGGCAAATCAGACATTCAAGG 0: 1
1: 0
2: 3
3: 12
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968072734 Original CRISPR TCTTAGCCTGCATTTTTTTG TGG (reversed) Intronic
904561341 1:31399573-31399595 TCTTAGGGTGCACATTTTTGAGG - Intergenic
907770677 1:57460388-57460410 TCTTTGCCTTCATTTCTGTGTGG - Intronic
908122223 1:60996986-60997008 TCTCAGCCTGCATCTCTCTGGGG - Intronic
909517167 1:76523952-76523974 TCTTCAGCTGCATTTTTTTCTGG - Intronic
909651632 1:77982298-77982320 TCTTATTCTCCCTTTTTTTGTGG + Intronic
910214852 1:84833011-84833033 TCTTAGCCTTTATATTTATGTGG - Intronic
910289333 1:85584859-85584881 TCTTAGGCAGTATTTTTCTGTGG - Intergenic
911978521 1:104534751-104534773 TGTTAGCTTCCATATTTTTGAGG + Intergenic
913561818 1:120028782-120028804 TCTTTTCCTTCATTTTTGTGAGG - Intronic
913636308 1:120764812-120764834 TCTTTTCCTTCATTTTTGTGAGG + Intergenic
914282402 1:146188179-146188201 TCTTTTCCTTCATTTTTGTGAGG - Intronic
914543430 1:148638894-148638916 TCTTTTCCTTCATTTTTGTGAGG - Intronic
914623192 1:149432114-149432136 TCTTTTCCTTCATTTTTGTGAGG + Intergenic
916386309 1:164274927-164274949 TCTTAGCAGTGATTTTTTTGGGG + Intergenic
916637288 1:166686373-166686395 CCTTTGCCTGCATTTTAATGGGG + Intergenic
917479509 1:175399703-175399725 TCTTAGCCTTACTTTCTTTGGGG + Intronic
917503907 1:175611127-175611149 AATTAGCCTGCAATTTTTTAAGG - Intronic
917728643 1:177852111-177852133 TCTTCCCTTGCAGTTTTTTGAGG + Intergenic
918634034 1:186753639-186753661 TCTTCCCCTGCCTTTTTTGGGGG - Intergenic
919028807 1:192212198-192212220 TCTTTGCCTACATTTTAATGGGG - Intergenic
919307221 1:195856726-195856748 GCTTAGGCTGCACTTCTTTGTGG - Intergenic
921461888 1:215437636-215437658 TACTAGCCTGCAGTTTTTTGGGG + Intergenic
922149666 1:222987968-222987990 TCTTAGTTTGCATTTTGTGGAGG + Intronic
922450548 1:225733767-225733789 TATTAGCATGTATTTATTTGGGG + Intergenic
923533693 1:234831668-234831690 ACTATGCCTGCTTTTTTTTGGGG - Intergenic
924187265 1:241506584-241506606 TCTATGTTTGCATTTTTTTGGGG - Intronic
924250358 1:242126971-242126993 CCTTAGCCTACTTTTTTATGGGG - Intronic
924889692 1:248261271-248261293 CCTTTGCCTACATTTTTATGGGG - Intergenic
1063661585 10:8037843-8037865 TCTTCTCCTACTTTTTTTTGGGG + Intergenic
1065020537 10:21498735-21498757 TCTTAGCCTCAGTTATTTTGGGG + Intergenic
1065270751 10:24031011-24031033 TCTTTGCTTTCATTTTTTGGGGG + Intronic
1065529779 10:26656890-26656912 TATTACCCTGGATTTTTCTGGGG + Intergenic
1065557162 10:26928064-26928086 TATTACCCTGGATTTTTCTGGGG - Intergenic
1065779740 10:29156237-29156259 GCTTAACTTGCATTTTTTTGTGG + Intergenic
1066090530 10:32014433-32014455 TCGGAGCCTGCTTTTTTTTCCGG - Intronic
1066655554 10:37696566-37696588 GGTTTGCCTGCATTTTATTGAGG - Intergenic
1066990775 10:42511169-42511191 TCTCAGCTTACATTTATTTGGGG + Intergenic
1067013769 10:42739866-42739888 TCTCTGCCTGCTTTTTTTGGGGG - Intergenic
1067310010 10:45103870-45103892 TCTCTGCCTGCTTTTTTTAGGGG + Intergenic
1068428548 10:56900897-56900919 TCTAAGTCTGTATTTTTTTAAGG + Intergenic
1068492949 10:57746921-57746943 TCTTTGCCTACATTTTAATGGGG + Intergenic
1068718472 10:60215184-60215206 TCTTTGCCTGCTTTTTGATGGGG + Intronic
1068957626 10:62833488-62833510 TCTTACCCATCATTTTTTTATGG - Intronic
1069172980 10:65255691-65255713 TCTGATCCTGGACTTTTTTGGGG - Intergenic
1069270896 10:66526136-66526158 TCTTGGCTTGCAATTATTTGGGG + Intronic
1072218840 10:93310484-93310506 TCTCAGCCTGCAGGTGTTTGGGG + Intronic
1072600804 10:96926230-96926252 TCTTGGTTTGCATTTTTTGGTGG + Intronic
1072801940 10:98398224-98398246 TCTTTGCCTGTATTCTTTTCCGG + Intronic
1073562085 10:104505715-104505737 GCTTGGCCAGCAGTTTTTTGAGG - Intergenic
1073651015 10:105358114-105358136 TCTGAGCCTTCATTCTTTTATGG + Intergenic
1073707829 10:106006114-106006136 TCTTAGCCATTATTATTTTGGGG - Intergenic
1074643222 10:115412924-115412946 TCTTAATTTGCATTTCTTTGGGG + Intronic
1074855328 10:117469073-117469095 TCTTAGCCTCCATTATTGTGGGG + Intergenic
1075135636 10:119783168-119783190 TTTTTGTCTGCATTTTTTTTGGG + Intronic
1075355861 10:121774838-121774860 TTTTAATCTTCATTTTTTTGGGG - Intronic
1075899382 10:126027464-126027486 TGTTTGCCTGTATTTTGTTGAGG - Intronic
1079113070 11:17617428-17617450 TCTGAGCCTGGATTTTTCTCTGG + Intronic
1079586569 11:22132373-22132395 TCTCAGCCTGGATGTTATTGAGG - Intergenic
1080923807 11:36735086-36735108 TGTTAGCTAGCATTTTGTTGAGG - Intergenic
1080942744 11:36938097-36938119 TCTTAACATGCCCTTTTTTGGGG + Intergenic
1081150662 11:39626770-39626792 TCTTACCCTGCATTTTTGTCTGG + Intergenic
1083810558 11:65103275-65103297 CCATTGCCTGCATTTTGTTGGGG - Intronic
1083872067 11:65494696-65494718 TTTTAGCCTGGGCTTTTTTGAGG + Intergenic
1084525709 11:69696823-69696845 TCTGAGCCTGCATCCTTCTGCGG - Intergenic
1084837407 11:71813129-71813151 TCTTACTATGCATTTTTTTTTGG - Intergenic
1086226381 11:84515316-84515338 TCGTAGGCTGCATATATTTGGGG - Intronic
1086324730 11:85686559-85686581 TCATAGACTGAAATTTTTTGAGG - Intergenic
1088650208 11:111951276-111951298 TCTGGGCCTGTACTTTTTTGAGG - Intronic
1089042260 11:115463110-115463132 ATTTTGCATGCATTTTTTTGGGG - Intronic
1090104672 11:123839906-123839928 TCTTAGCATTCATTTGGTTGAGG - Intergenic
1090932198 11:131308090-131308112 TCTTATCCTTAATTGTTTTGTGG - Intergenic
1093095705 12:14969817-14969839 TCTTAGTCTTCCTTTGTTTGAGG + Intergenic
1093784061 12:23172289-23172311 TCTGAGCCTCCAATTTTATGTGG + Intergenic
1093829181 12:23734957-23734979 TCTTAGGCTTCATTTGTTTTAGG - Intronic
1093849545 12:24018977-24018999 TATAATCATGCATTTTTTTGAGG + Intergenic
1094266381 12:28564955-28564977 TGTTAGCCTGCATCTTCTTTAGG + Intronic
1094877656 12:34669469-34669491 TCTTTGCCAGTATTTTATTGAGG + Intergenic
1095248690 12:39953335-39953357 TATTAGACTGCATTTTTTAATGG + Intronic
1095285577 12:40406602-40406624 TTATGGCCTGCAATTTTTTGGGG + Intronic
1095629999 12:44365167-44365189 TCTCAGCCTGCATATTTTGTAGG + Intronic
1096110288 12:49024731-49024753 CCTTAGCCTGAGTTTTTTTGGGG + Intronic
1096384983 12:51189390-51189412 TCTTAACCCACGTTTTTTTGTGG + Exonic
1097750990 12:63352611-63352633 TTTTAGCATTCATTTTTTAGTGG + Intergenic
1098622384 12:72618027-72618049 TCTTAGCCTTGATGTCTTTGCGG - Intronic
1099035691 12:77584850-77584872 TTTTACCCTACATTTTTTTGAGG - Intergenic
1099146352 12:79049361-79049383 TCTTTTCATGCATTTTTATGTGG + Intronic
1101678170 12:106938702-106938724 TATTAGTCTACATTTTTTGGGGG + Intergenic
1101690188 12:107071578-107071600 TCTAAGCCTGATGTTTTTTGTGG + Intronic
1101693432 12:107102333-107102355 TCTTAGCCTGCAGGCTTCTGAGG - Intergenic
1101859859 12:108474342-108474364 TTTTGGTCTTCATTTTTTTGAGG + Intergenic
1102641297 12:114369205-114369227 TCTCAGCCAACATTTTTTGGAGG - Intronic
1102993195 12:117329418-117329440 TCTTGGCCTGGATTTTTTGGTGG + Intronic
1103384698 12:120522937-120522959 TGTTGGCCTGCATCTTTTTTAGG + Intronic
1103487827 12:121295407-121295429 TCTGAAACTGCATGTTTTTGTGG + Intronic
1104073201 12:125365123-125365145 TCTTTTCCTGCTTTTTTTTTGGG + Intronic
1105283799 13:18987450-18987472 TGTTTGCCTGTATTTTATTGAGG - Intergenic
1105733955 13:23248249-23248271 TCTCTCCCTGCATTTTTGTGTGG + Intronic
1105835843 13:24211518-24211540 TTTTAGCCTTGATTTTGTTGAGG + Intronic
1106669069 13:31885797-31885819 TCTAAGCCTGTAACTTTTTGGGG + Intergenic
1106685351 13:32053288-32053310 TCTTAGACTGGATTTTATTTTGG + Intronic
1107281542 13:38741767-38741789 TCTAGGCATGCATTTTTATGAGG + Intronic
1107640958 13:42442810-42442832 ACTTGGCCTGCACTTCTTTGAGG - Intergenic
1109095864 13:58115958-58115980 TGTTAGCATGCATTGATTTGCGG - Intergenic
1109243851 13:59928674-59928696 GCTTAGGCTGCAGTTGTTTGTGG + Intronic
1110199393 13:72830893-72830915 TCTCATCCTGGATTTTTTTTTGG + Intronic
1110575084 13:77046763-77046785 TCTGTGCCTGCATTTGTCTGAGG - Intronic
1110992549 13:82061218-82061240 TCTTTGTCTGCTTTTTTATGGGG + Intergenic
1111075980 13:83236090-83236112 TCTTAGCCTACATAATTTTAGGG + Intergenic
1111201475 13:84943860-84943882 TGTTAGAATGCATTTTTTTCTGG - Intergenic
1111368680 13:87286562-87286584 CCTTAGCCCTTATTTTTTTGTGG - Intergenic
1111437950 13:88236789-88236811 TGTTGGCCTGCATTTTCTTCAGG + Intergenic
1111532624 13:89558950-89558972 TCCTTGCCTGGCTTTTTTTGGGG - Intergenic
1114692739 14:24600502-24600524 TCTTAGGCTGCAGTTATTAGTGG + Intergenic
1114754968 14:25248525-25248547 TCTTAGACTCTGTTTTTTTGAGG + Intergenic
1114771566 14:25432779-25432801 TCTTTGCCAGTATTTTATTGAGG - Intergenic
1114776272 14:25485640-25485662 TCTGAGCCTGCACTTTTAAGAGG - Intergenic
1115213967 14:30996505-30996527 TCTTGACCTGCCTTTTTTTGTGG - Intronic
1115512237 14:34149045-34149067 TCTCACCTTACATTTTTTTGGGG + Intronic
1116879929 14:50156006-50156028 TCTAAAACTGCATTTGTTTGTGG + Intronic
1117350226 14:54874089-54874111 GGTTAGCCAGCATTTTTTTGAGG - Intronic
1117357644 14:54940914-54940936 GTATAGCCTGGATTTTTTTGAGG - Exonic
1117568300 14:57019240-57019262 TCTCAGACTGCATTCTTTGGGGG + Intergenic
1117834735 14:59791841-59791863 GGTTAGCCTGGATTTTTTTTTGG + Intronic
1118014814 14:61649278-61649300 TCTAATACTGCATTATTTTGTGG - Intronic
1118210247 14:63759467-63759489 ACTTTGCATTCATTTTTTTGAGG + Intergenic
1118525318 14:66634404-66634426 GCTTAGCCTGCAGTTGTTTGTGG + Intronic
1119011566 14:70996114-70996136 TCTTATTCTGCATTTTCTTTTGG + Intronic
1119446213 14:74665590-74665612 TCTTAGGATGCATTCTTTTGTGG + Intronic
1120085192 14:80263998-80264020 TCTTAGCCTGAATATAATTGTGG + Intronic
1120116299 14:80621910-80621932 TTTTAGCCTTCATTCTCTTGGGG - Intronic
1120495261 14:85226646-85226668 TCTTAGCCTTCATTTTCTGAAGG + Intergenic
1120600851 14:86506358-86506380 AATTAGCCATCATTTTTTTGTGG - Intergenic
1120791784 14:88590688-88590710 TTTTAGCATGTATTTTTTTGGGG + Intronic
1124359902 15:29028830-29028852 TCTTTGCCTGCTTTTTAATGGGG + Intronic
1125481958 15:40087397-40087419 TCCTGGCTTGCATTTCTTTGTGG - Intergenic
1125491429 15:40151570-40151592 TCTTAGAGTGAATTTTCTTGAGG + Intergenic
1126647655 15:50891284-50891306 TATTTGCCTGCACTATTTTGAGG - Intergenic
1126743558 15:51802082-51802104 CCTCAGCCTGCATCTTTTTTTGG - Intronic
1127031363 15:54867360-54867382 TCTTATCCTTTATATTTTTGTGG - Intergenic
1127198543 15:56617302-56617324 TCTGAGCCTGCATTTTTGATGGG + Intergenic
1127310524 15:57748036-57748058 TGATAGACAGCATTTTTTTGTGG + Intronic
1127620628 15:60730376-60730398 TCATAGCCTGATTTCTTTTGTGG + Intronic
1127650272 15:60999957-60999979 TGTTAGGATGCCTTTTTTTGAGG - Intronic
1128373657 15:67059734-67059756 CCTAAGCCTGCATGTTTTAGGGG + Intergenic
1128791634 15:70438752-70438774 TCTTGCCCTGCATTCTTATGTGG - Intergenic
1130629762 15:85555033-85555055 TCTTTTCCTTCCTTTTTTTGGGG - Intronic
1130875364 15:88009083-88009105 TCATTGTCTGCATGTTTTTGAGG + Intronic
1131281928 15:91028651-91028673 TCCTGGGCTGTATTTTTTTGTGG + Intergenic
1133080711 16:3317297-3317319 TCTTTGCCTGCTGTTTTCTGGGG - Exonic
1134122407 16:11594490-11594512 TCATAGTCTGCATTCTTTTAGGG - Intronic
1134828844 16:17307048-17307070 TATGAGCCTGCAGTTTTGTGGGG + Intronic
1135692043 16:24546550-24546572 TCTTTGACTACTTTTTTTTGTGG + Intronic
1143930792 17:10421673-10421695 TCTGAACCTGCATTTTTATCTGG - Exonic
1144930446 17:18854901-18854923 TCTTAGCTCTCAATTTTTTGTGG + Intronic
1147052812 17:37809295-37809317 TTTTAAACTGCATTTCTTTGAGG + Intergenic
1147795871 17:43042344-43042366 TTTTCTCCTGCATATTTTTGAGG + Intergenic
1149618245 17:58020239-58020261 TCCTAGCCTGGATTTAGTTGAGG - Intergenic
1150049767 17:61950004-61950026 TGTTATGCTGCATTATTTTGGGG - Intronic
1151231682 17:72689653-72689675 ACTTAGCATGGATGTTTTTGAGG - Intronic
1153152954 18:2115292-2115314 TTTTAGCCAGCATTTCTATGTGG - Intergenic
1153556462 18:6319889-6319911 GCTTAGCTAGCATTTTGTTGAGG - Intronic
1153885736 18:9463931-9463953 ACTTAGCATGCTTTCTTTTGAGG + Intergenic
1154933177 18:21022157-21022179 CTATAGCCTACATTTTTTTGTGG - Intronic
1155730892 18:29156875-29156897 TCTTAGTCTGCATCTTCTTGGGG - Intergenic
1156547144 18:37975127-37975149 TGTTAGCCTTCTTTTGTTTGGGG + Intergenic
1156779359 18:40832657-40832679 TCTTTGCCTGCTTTTTAATGGGG - Intergenic
1156917817 18:42482413-42482435 TCTCAGCCTCCATTCTTCTGTGG + Intergenic
1157753988 18:50202142-50202164 TTTTATCCTACATTTTTTTGTGG - Intergenic
1158030457 18:52958243-52958265 TTATAATCTGCATTTTTTTGTGG + Intronic
1158233587 18:55287016-55287038 TCTTACCATGAATTGTTTTGGGG - Intronic
1158238700 18:55351144-55351166 TCTTAGACTGCCTTTCTTTTGGG - Intronic
1158264152 18:55641223-55641245 TCTTGGTGTGCATTTTTTAGGGG - Intronic
1158370032 18:56790632-56790654 TCTCTTCCTGCTTTTTTTTGTGG + Intronic
1158859810 18:61581394-61581416 TCTTTGCTTTTATTTTTTTGAGG - Intergenic
1159494828 18:69189345-69189367 TTTTAGCCTACTTTTTTTTTGGG - Intergenic
1159938381 18:74386710-74386732 TCTCAGTCTGCCTTTCTTTGTGG + Intergenic
1160319372 18:77875878-77875900 TCTTAAGATACATTTTTTTGGGG - Intergenic
1161544052 19:4869027-4869049 TCTGTGACTGCATTTTTTTGGGG + Intergenic
1163088513 19:15001396-15001418 TCTTATTCTGCATTTTTATATGG - Intronic
1163464126 19:17456209-17456231 TCTTAGCCTGCAAATGTCTGAGG - Intronic
1164543081 19:29136323-29136345 TCTTTGCCAGTATTTTATTGAGG - Intergenic
1165218671 19:34296563-34296585 TGTTGGCCTGCATCTTCTTGAGG + Intronic
1165236725 19:34428043-34428065 CCTTTGCCTATATTTTTTTGGGG + Intergenic
1165292760 19:34902046-34902068 TTTTAACATGTATTTTTTTGTGG + Intergenic
1165330274 19:35137946-35137968 TCTTAGAATGCATTTATGTGCGG + Intronic
1167712345 19:51120149-51120171 TCTTCTCCTGCAATTGTTTGGGG - Intergenic
925974385 2:9131329-9131351 TTTTTTCCTGCATTTTTTTTGGG - Intergenic
926178883 2:10622519-10622541 TCTGTGCCTGTATTCTTTTGGGG - Intronic
926954208 2:18276149-18276171 TCTTAGCATGGATTTTTTTAAGG + Intronic
927669717 2:25058951-25058973 TCTTTGCATTCATTTCTTTGGGG - Intronic
928467993 2:31541145-31541167 TCTGAGCTTGCATCTTTCTGTGG - Intronic
929962448 2:46506886-46506908 TCTTAGCCTTCATGTCTATGTGG - Intronic
930673362 2:54174924-54174946 TCTTTGCCAGTATTTTATTGAGG + Intronic
931160189 2:59681094-59681116 TCTTAGGTTGCAGTTTTTGGTGG - Intergenic
931704078 2:64932498-64932520 TCTTGGGCTGCATTTTTTCAGGG + Intergenic
931762266 2:65428974-65428996 TTTTAACATGCATTTTTATGTGG + Intronic
934672917 2:96227536-96227558 TCTGATCAGGCATTTTTTTGGGG - Intergenic
934675924 2:96249659-96249681 TCTTCCTCTGCATTTTTTGGGGG - Exonic
935980878 2:108625584-108625606 TTTCAAACTGCATTTTTTTGGGG - Intronic
936441066 2:112553971-112553993 TCTTAGATTACATCTTTTTGAGG - Intronic
937779190 2:125818220-125818242 TGTTAGCCTGAATTTATATGTGG - Intergenic
938739879 2:134221000-134221022 CCTTGTCCTGCAGTTTTTTGTGG + Intronic
938746691 2:134285737-134285759 TCTTATCTTGCATTTTTTTGAGG + Intronic
939168602 2:138667025-138667047 TCTTAGCCTCCATAATTGTGTGG + Intergenic
939461716 2:142504703-142504725 TCTTAGCATGGATTTTTTTGGGG - Intergenic
940236358 2:151515112-151515134 TCTCAGCCTGAATTTCCTTGTGG - Intronic
940317347 2:152339012-152339034 TATTAGCCTGTGTTTTTTGGGGG + Intronic
940630019 2:156226410-156226432 TGTTTGCCAGCATTTTGTTGAGG - Intergenic
941458654 2:165740236-165740258 TCATAGCCTCCATTACTTTGAGG + Intergenic
942127406 2:172841058-172841080 CCATAGCATGCATTTTTCTGGGG - Intronic
942526665 2:176860584-176860606 TCTTAGCATGAATATCTTTGAGG + Intergenic
942540507 2:177010236-177010258 TCTAAGTCTGCCTTTCTTTGTGG + Intergenic
942576498 2:177369031-177369053 CCTTAGCCTGCTTTTTGATGGGG + Intronic
942760304 2:179389492-179389514 TGTTTGCCAGCATTTTATTGAGG - Intergenic
942978546 2:182049429-182049451 TCTTTTCCTGCACTATTTTGTGG - Intronic
943066331 2:183090692-183090714 TTATAGCCTGCCTTTTTTTTGGG + Intronic
943677167 2:190727256-190727278 TCTTAACCTCCATTTGTGTGGGG - Intergenic
943714778 2:191138849-191138871 TGTTAGCTAGCATTTTGTTGAGG - Intronic
944144925 2:196497158-196497180 TTTTAGCATGCATATTTTGGGGG - Intronic
944353994 2:198763347-198763369 TCTAACCCTGCAATTTTGTGTGG - Intergenic
945828503 2:214754417-214754439 TCTTAGATTTTATTTTTTTGAGG - Intronic
947069009 2:226265057-226265079 ACTTTGCCTGTATTTCTTTGAGG + Intergenic
948588001 2:239033015-239033037 TCTGAGCCTGGGCTTTTTTGTGG + Intergenic
1169899546 20:10538828-10538850 TCTTTGGCTGTATTATTTTGAGG + Intronic
1170322871 20:15120237-15120259 TCTTAGACTGTATTTTTAAGGGG + Intronic
1173068107 20:39734066-39734088 CCATAGTCTGCATTTCTTTGTGG - Intergenic
1173359547 20:42329792-42329814 TATAAGCATGCATTATTTTGTGG + Intronic
1173723463 20:45280133-45280155 CCTGAGCCTCAATTTTTTTGAGG + Intergenic
1174482482 20:50841507-50841529 TCTTAGCCTCCATTTTAGAGGGG - Intronic
1174897554 20:54467028-54467050 TGTTAGCCTAGATTTTTTTTTGG + Intergenic
1176881469 21:14199799-14199821 TATTGGCCTGAAGTTTTTTGTGG - Intronic
1177088993 21:16742524-16742546 TCTTCTCTTGCATTTATTTGGGG - Intergenic
1178620328 21:34168566-34168588 TCTTTCCCTGCCTTTTTTTCAGG + Intergenic
1179531503 21:42022589-42022611 TCTTGGCCTGCATCTTCATGCGG - Intergenic
1180097893 21:45568755-45568777 TCTTCTCCTTCATTTATTTGTGG - Intergenic
1181579530 22:23820124-23820146 AGTTTGCCAGCATTTTTTTGAGG + Intronic
1183550619 22:38481627-38481649 TATTGGCCTGCATGTTTTTATGG - Exonic
1183808352 22:40232628-40232650 TCTAACCCTGAAATTTTTTGCGG + Intronic
1184385812 22:44173948-44173970 TCTTCGCCTGCACTTTTATTGGG + Intronic
1184848753 22:47105666-47105688 TTTTAGCTTGCAATTTTTTTAGG - Intronic
949976085 3:9461431-9461453 TATTAGCATGCGTTTATTTGTGG + Intronic
952631914 3:35479762-35479784 TCTTTGCCAGTATTTTATTGAGG + Intergenic
953179220 3:40580982-40581004 GCTTTGCCTGCATTTATCTGTGG + Intergenic
953602234 3:44378424-44378446 TCTTTGCCTGCTTTTTAATGGGG - Intronic
954907003 3:54071554-54071576 CCTTCCCCTGCATTTTTTAGGGG - Intergenic
955491913 3:59491300-59491322 CCTTTGCCTACATTTTTATGGGG + Intergenic
955877050 3:63502225-63502247 TTTTAGACTTCATTTTTTAGAGG + Intronic
958165704 3:89876191-89876213 GCTTAGACTGCAATTGTTTGTGG + Intergenic
958744917 3:98121753-98121775 TGTTTGCTTGCATTTTGTTGAGG - Intergenic
959556895 3:107730083-107730105 TGTTAGACTTCATTTTTTAGAGG - Intronic
960685317 3:120288583-120288605 TGGTAACCTGCATTTTTCTGGGG + Intergenic
962013263 3:131414524-131414546 TCTTAGCTAGTATTTTGTTGAGG - Intergenic
962491750 3:135900913-135900935 TCTTATCCCGCATTGTTTTCTGG + Intergenic
963042807 3:141081736-141081758 GCTGAGCCTCCATTTCTTTGTGG + Intronic
963471298 3:145745450-145745472 TCTTATGCAGCAGTTTTTTGGGG - Intergenic
964261050 3:154837109-154837131 TTTTAGCCTTCATTTTTTTTCGG + Intergenic
964776551 3:160285418-160285440 TCTTAGCCAGCATTTTCTTTAGG - Intronic
965112131 3:164440025-164440047 TCTTGATCTGCAGTTTTTTGAGG - Intergenic
965182214 3:165418528-165418550 TGTTTGCCAGTATTTTTTTGAGG - Intergenic
966907828 3:184540473-184540495 TCTGAGCCTGTATTTTCTTGAGG + Intronic
967087132 3:186106001-186106023 TTTTAGACTGCCTTTTTTTTAGG + Intronic
968072734 3:195796723-195796745 TCTTAGCCTGCATTTTTTTGTGG - Intronic
969028700 4:4194298-4194320 TATTCGGCTGCATTTTTTTGAGG - Intronic
970178629 4:13364375-13364397 TCGTAGCCTGCATTAATTAGGGG - Intronic
970363844 4:15337931-15337953 TAGTAGCCTCCAATTTTTTGAGG - Intergenic
970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG + Intronic
971283894 4:25268327-25268349 TCTTATCCTGTCCTTTTTTGGGG + Intronic
971528186 4:27649527-27649549 TCTTAGATTGCATTTATCTGTGG + Intergenic
972203640 4:36745872-36745894 TTTTATCATGAATTTTTTTGAGG - Intergenic
972295579 4:37734775-37734797 TCTTGGCCCCCATTTTTCTGAGG + Intergenic
972560920 4:40228275-40228297 TATTAGCATACATTTTTCTGGGG - Intronic
972672258 4:41224998-41225020 TCTTTGCCTCCATTTTCCTGGGG - Intergenic
972843862 4:42963939-42963961 TCTTAACCTTCATTTTTCAGAGG + Intronic
973721817 4:53731657-53731679 TCTTAGCCTTCGTTTGTTTCAGG + Intronic
973964046 4:56142352-56142374 TCTTTGTCTTTATTTTTTTGTGG + Intergenic
974845210 4:67343479-67343501 TCATTTCCTGCCTTTTTTTGTGG - Intergenic
974996607 4:69167574-69167596 TCTTAGTGTGGGTTTTTTTGAGG + Intronic
975016396 4:69425941-69425963 CCTTAGCCTACATTTTGTTGGGG + Intergenic
976151191 4:82093664-82093686 ACTTTGCATGCAGTTTTTTGGGG - Intergenic
976207686 4:82638285-82638307 TCGTGGTCTGCTTTTTTTTGGGG - Intronic
976953947 4:90870581-90870603 TGTTTGCCAGCATTTTGTTGAGG + Intronic
977869665 4:102076323-102076345 TTTTGGCCTGCCTTATTTTGTGG + Intergenic
977874872 4:102137447-102137469 TCTGAGCCTCCATTTCTTTATGG + Intergenic
978406685 4:108386577-108386599 TCTTAGTATACATTTCTTTGGGG - Intergenic
978750282 4:112238288-112238310 TCCTATCCTTCATTTTTTTAAGG + Intronic
979009697 4:115352029-115352051 TGTTTGCCTGTATTTTATTGAGG + Intergenic
979628188 4:122870228-122870250 TGTTTGCCGGCATTTTATTGAGG + Intronic
980429445 4:132673038-132673060 TCTTAGGCAGTATTTTTCTGTGG - Intergenic
982250194 4:153398273-153398295 TCTTAGCCTGTCTTTTATTTAGG + Intronic
983048413 4:163014233-163014255 TGTTAGGCTGTATGTTTTTGTGG + Intergenic
984324461 4:178234355-178234377 TCTTAGCCTACTTTTTGATGGGG + Intergenic
984522478 4:180818138-180818160 TCATTGCCTGGATGTTTTTGAGG + Intergenic
985166928 4:187106151-187106173 TCTTAGCCTTTTTTTTTTAGTGG + Intergenic
988270210 5:29004096-29004118 ATCTTGCCTGCATTTTTTTGTGG - Intergenic
989549739 5:42720337-42720359 TCTTAGCATGTATTTTTTTTTGG - Exonic
989696244 5:44204049-44204071 TGTTTGCCAGTATTTTTTTGAGG + Intergenic
989766357 5:45089176-45089198 TCTTTCCCTTCACTTTTTTGGGG + Intergenic
989784362 5:45309761-45309783 TGTTTGCCAGCATTTTGTTGAGG + Intronic
992314208 5:75536239-75536261 TCTGTGCCTACATTTTTTGGGGG + Intronic
992715815 5:79510592-79510614 TGTTAGCCTGCATCTTCTTTAGG - Intronic
993389339 5:87299101-87299123 TCTAAGGTTGCAATTTTTTGAGG - Intronic
993779603 5:92050447-92050469 TCTTAGCTTCCATTTTTGTTAGG + Intergenic
993878073 5:93331566-93331588 TCTTGTATTGCATTTTTTTGAGG - Intergenic
994060276 5:95468741-95468763 TCTTAGACTGCATTTTTATTTGG + Intronic
994285588 5:97961674-97961696 TTTTAGCCTGAATTTTATTTTGG + Intergenic
994329058 5:98484854-98484876 TCTTAGGCTGCATTAGTTTCTGG - Intergenic
994636357 5:102349097-102349119 GGTTAGCTAGCATTTTTTTGAGG - Intergenic
995150032 5:108832350-108832372 TCTTAACCTGCATCTCTCTGTGG - Intronic
995197708 5:109392057-109392079 TCCCAGCAGGCATTTTTTTGGGG + Intronic
995948731 5:117683469-117683491 TCTTAGCCTCCTTTTGGTTGAGG + Intergenic
996172655 5:120313258-120313280 TCTTAGCCTGAAGTTTTGGGTGG + Intergenic
996867364 5:128140704-128140726 TCTATGCCTGAAATTTTTTGGGG - Intronic
997080334 5:130731295-130731317 TCTTAGCTTTCCTTTTTCTGGGG - Intergenic
998863556 5:146471411-146471433 TGTTTGCCTTCATGTTTTTGTGG + Intronic
1000080577 5:157841612-157841634 TCTGAGCCATCATTTTTTTTCGG + Intronic
1000180014 5:158799773-158799795 GCTAGGCCTGCATTTTTATGGGG - Intronic
1001168570 5:169394273-169394295 TCTTAATCTGCATGTTGTTGGGG - Intergenic
1002171395 5:177376777-177376799 TCTTAGCTTTAATTTTTTTAAGG + Intergenic
1003200334 6:3954207-3954229 GGTTTGCCTGCATTTTGTTGAGG + Intergenic
1003386774 6:5675052-5675074 TTTTAATCTGCATTTTTTGGGGG + Intronic
1003932052 6:10933642-10933664 TCTTAGTATTTATTTTTTTGTGG + Intronic
1004049288 6:12059351-12059373 TCTTATCCTACATTTTTTGGGGG + Intronic
1004454089 6:15775193-15775215 TCAGAGCCTGCATTTTATTAAGG - Intergenic
1004674514 6:17828234-17828256 TCTTACCTTGCATTTTCTTTTGG + Exonic
1004739124 6:18439916-18439938 TGCTAGTCTGCATTTTTTTCTGG - Intronic
1004760456 6:18660093-18660115 TATTGGCCTGAAGTTTTTTGTGG - Intergenic
1004957137 6:20740311-20740333 TGTTAGCATACTTTTTTTTGGGG + Intronic
1006167639 6:32074428-32074450 TCTGAGGCTGCATTTGTTGGGGG + Intronic
1006286554 6:33100202-33100224 TGTTAGCTTGTATTTTGTTGAGG - Intergenic
1007391923 6:41554371-41554393 ACTGAGCCTGCATTTCTGTGTGG + Intronic
1007459830 6:42009989-42010011 GCTTAGCCTGCATTCCTTGGAGG - Intronic
1007754394 6:44089528-44089550 TGTTGGCCTGCATCTTTTTTAGG + Intergenic
1008084020 6:47224772-47224794 TTTTAACCTGTACTTTTTTGGGG - Intergenic
1008623960 6:53299828-53299850 TCTTAGACTGCATTTCTTCTCGG + Intronic
1008936149 6:56994757-56994779 ATTTAGCCTACAGTTTTTTGGGG - Intronic
1009441413 6:63683875-63683897 TATTAGTCTGAATTTTTTAGAGG + Intronic
1009548987 6:65061922-65061944 TCTTACTCTTTATTTTTTTGTGG + Intronic
1010647581 6:78410263-78410285 TGTTAGCTAGCATTTTGTTGAGG - Intergenic
1010769605 6:79813054-79813076 TCTCAGCATGCTTTTTTTTTAGG - Intergenic
1010896450 6:81371045-81371067 TCTTAGCATCCCTGTTTTTGAGG - Intergenic
1010979799 6:82358913-82358935 TTTTATGCTGTATTTTTTTGTGG + Intergenic
1010997192 6:82547375-82547397 GCTTTGCCAGCATTTTATTGAGG + Intergenic
1011053256 6:83177444-83177466 TCTTACCCTTCTTTTTTTTTTGG - Intronic
1011665727 6:89630818-89630840 GCTTACCCAGTATTTTTTTGAGG + Exonic
1011678375 6:89758507-89758529 TCTTATACTGCAGTCTTTTGCGG + Intronic
1012299872 6:97573003-97573025 TCTTTGCCTACCTTTTTATGGGG - Intergenic
1014364814 6:120525933-120525955 AGTTTGCCTGCATTTTGTTGAGG + Intergenic
1014365672 6:120538310-120538332 TCTTAGCCAGCCTTCTTTTGGGG - Intergenic
1016885826 6:148958742-148958764 TCTAAGCTTGTATTTTTTGGGGG + Intronic
1020354486 7:7261806-7261828 TCCTAGCCTCCAAATTTTTGGGG - Intergenic
1021199140 7:17708173-17708195 TCTTAGCTGGCTTTTTTTTTTGG + Intergenic
1021687461 7:23201291-23201313 TCTTAGGCTGCTTTTTATTTTGG + Intergenic
1022767436 7:33429945-33429967 TCTAAGCCTGCATTAGCTTGTGG + Intronic
1023817097 7:43959480-43959502 TCTTAGCCTCCAAATTTTCGGGG + Intergenic
1024841119 7:53588740-53588762 GCTTAGCCTGCATTTATAAGTGG - Intergenic
1027938231 7:84636932-84636954 GCTTAGGCTGCATTTGTTAGTGG + Intergenic
1027968745 7:85048720-85048742 TTTTTGCCTTCATTTTTTAGTGG - Intronic
1030398716 7:109020782-109020804 CCTTAGTCTGCATTATCTTGGGG + Intergenic
1030858365 7:114590383-114590405 TCATAGCCTGCTATTTCTTGAGG + Intronic
1031140515 7:117937610-117937632 TCTTAGCCTTTATTTTTTCCTGG - Intergenic
1031326252 7:120402304-120402326 TCTTAGCATCCTTTTTTGTGGGG - Intronic
1032574618 7:133040132-133040154 TCTAAGTCTGCATGTTTTTGAGG - Intronic
1033476890 7:141701284-141701306 TCTCTGACTGCATTATTTTGAGG - Intronic
1033518901 7:142139933-142139955 TCTTTCCCTACATTTGTTTGTGG + Intronic
1036449471 8:8853213-8853235 TTTAAGCCTCCATTTTTTTTGGG - Intronic
1036944373 8:13080886-13080908 TCTTATCATGCATTTCTTAGTGG - Intergenic
1037047858 8:14332110-14332132 TTTCATCCTGCATTTTTTTGTGG - Intronic
1037153918 8:15676297-15676319 TCTTTGCCTGCTTTTTAATGGGG + Intronic
1037381246 8:18287552-18287574 TGTTGGACTGCATTTTCTTGTGG - Intergenic
1039628327 8:39079478-39079500 TATTAGCTTGCCATTTTTTGAGG + Intronic
1040687496 8:49892422-49892444 TTTTTGCTTGCATATTTTTGAGG - Intergenic
1041266495 8:56070569-56070591 GCTTGGCCTGGCTTTTTTTGTGG - Intronic
1042030377 8:64469625-64469647 GCTTAGCCTGCAGTTTTTGGTGG - Intergenic
1042326772 8:67537090-67537112 TGTTTGCCTGTATTTTATTGAGG + Intronic
1042944563 8:74142264-74142286 TCCTAGCTTTCATTTTGTTGGGG + Intergenic
1042981806 8:74538011-74538033 GGTTTGCCAGCATTTTTTTGAGG + Intergenic
1043417159 8:80063261-80063283 TCTTTCCCTTCATGTTTTTGAGG - Intronic
1043884645 8:85584695-85584717 TTTTAATCTGCATTTTTTGGTGG + Intergenic
1044065097 8:87689132-87689154 GCTTACCTTACATTTTTTTGTGG - Intergenic
1044550082 8:93502357-93502379 TTTTCTCCTGAATTTTTTTGAGG - Intergenic
1044561461 8:93616725-93616747 TCTCTGCCTTCACTTTTTTGGGG - Intergenic
1045802746 8:106120577-106120599 TCTGAGCTAGCATTTTCTTGTGG - Intergenic
1047997735 8:130352950-130352972 TTTTAGGCTGCATTTTTTGAGGG + Intronic
1050234020 9:3559256-3559278 TGTTTGCCAGCATTTTATTGAGG + Intergenic
1051500571 9:17772158-17772180 TCTTAGCATGCATTTCATTTTGG - Intronic
1052147245 9:25064679-25064701 TCTTAATTTGCATTTTTCTGAGG + Intergenic
1054874052 9:70076618-70076640 TCCTAGACTGGATTGTTTTGGGG + Intronic
1055973158 9:81931292-81931314 TCTTACCCTTCATTCTTCTGAGG + Intergenic
1055974911 9:81946384-81946406 TCTTACCCTTCATTCTTCTGAGG + Intergenic
1055979950 9:81991610-81991632 TCTTACCCTTCATTCTTCTGAGG + Exonic
1056251927 9:84757403-84757425 TCTTGTTCTGCATTTTTTGGGGG + Intronic
1056812931 9:89778184-89778206 TATTAGCCTGGATGATTTTGCGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057526573 9:95808232-95808254 CCTTAATCTGCATTTTTTTCTGG - Intergenic
1058199952 9:102027405-102027427 TCTTTGGATGCAATTTTTTGTGG + Intergenic
1059040427 9:110808852-110808874 TCTAAGTCTGGGTTTTTTTGTGG - Intergenic
1059899367 9:118905670-118905692 TCTTAGCCTGCAGTTGTAAGAGG + Intergenic
1060441643 9:123645378-123645400 TCTCAGCCTGAGATTTTTTGAGG - Intronic
1061645684 9:131999206-131999228 TCTTACCCTGCTATGTTTTGGGG - Intronic
1062296701 9:135833975-135833997 CCTTAGCCTGCTTTTTATTTGGG - Intronic
1062373782 9:136253062-136253084 TCTTACCCAGCATTTCTTTGGGG + Intergenic
1186584425 X:10857164-10857186 TCAGAGCCTGGATTTTATTGTGG + Intergenic
1186628051 X:11316334-11316356 TCTTCACCTGTATTTTTTTCTGG - Intronic
1187366832 X:18672690-18672712 TCTTCGCCATCATTTTTTAGGGG + Intergenic
1187913381 X:24131316-24131338 TTTTTGTCTTCATTTTTTTGGGG + Intergenic
1188080282 X:25830186-25830208 TCTTAGCTTTCCTTTTGTTGAGG + Intergenic
1188557260 X:31426731-31426753 TCTTAGGCTGCATTCTTAGGGGG + Intronic
1189045276 X:37584213-37584235 GGTTTGCCAGCATTTTTTTGAGG + Intronic
1192031345 X:67516083-67516105 ACTTTGCCTGCATTTTATTTGGG - Intergenic
1192061210 X:67828916-67828938 GTTTTCCCTGCATTTTTTTGTGG - Intergenic
1192721658 X:73705138-73705160 TGTTTGCCAGTATTTTTTTGAGG - Intergenic
1193112546 X:77743954-77743976 TCTTAGCTTGAGTTTATTTGTGG - Intronic
1193165104 X:78271007-78271029 ACTTATCCTGCATTTTTTATAGG - Intergenic
1193274986 X:79575585-79575607 TTTTAACCTCAATTTTTTTGGGG + Intergenic
1193435653 X:81472103-81472125 TCTGGTCCTGCATTTTTTTTTGG + Intergenic
1193665741 X:84314106-84314128 TCTTGGCTTGTATTTTATTGTGG - Intergenic
1194378998 X:93170983-93171005 TATTAGCCTGTAGTTTTTGGGGG - Intergenic
1194394917 X:93371631-93371653 TCTTTGCCTTCATTTTATTTGGG + Intergenic
1194412596 X:93575492-93575514 TCTTTACCTGCATTATTTTCTGG - Intergenic
1194478024 X:94383553-94383575 TGTTATCCTGCATTTCTCTGAGG - Intergenic
1194652862 X:96536179-96536201 TTTTTGCTTGCATTTCTTTGTGG - Intergenic
1195146988 X:102027600-102027622 GCTTAGCCTGCAGTTATTAGTGG - Intergenic
1195507436 X:105673991-105674013 TCTTTGCCTGCTTTTTAATGGGG + Intronic
1195621806 X:106963782-106963804 TCTCAGCTTGCATTTTTTTCTGG - Intronic
1195682324 X:107557292-107557314 TCTTTGCCTGCTTTTTTATTGGG + Intronic
1195996909 X:110740709-110740731 TCTTATCCTCCATTCTTTTGGGG - Intronic
1196341006 X:114597463-114597485 TCTTTTCCTTCATTTTTATGTGG - Intronic
1196549991 X:117012888-117012910 TCTTTTCCAGTATTTTTTTGAGG - Intergenic
1197056381 X:122124815-122124837 TCTTTACCTCAATTTTTTTGGGG - Intergenic
1197345728 X:125324649-125324671 GCTCTGCCTGCATTTTTGTGAGG - Intergenic
1197484721 X:127034365-127034387 TCTTTGCTAGCATTTTGTTGAGG - Intergenic
1198020111 X:132649306-132649328 TCTTTCCCTGCATTTTGATGGGG + Intronic
1198300949 X:135333792-135333814 TTTTAGACTGATTTTTTTTGGGG - Intronic
1199051177 X:143238759-143238781 TCTTAGTCTGCCTTTTTGGGGGG + Intergenic
1200010554 X:153117352-153117374 TATTTGCTAGCATTTTTTTGAGG + Intergenic
1200029046 X:153282570-153282592 TATTTGCTAGCATTTTTTTGAGG - Intergenic