ID: 968074517

View in Genome Browser
Species Human (GRCh38)
Location 3:195809203-195809225
Sequence CCTTAAGGAAACCCTCATTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968074505_968074517 30 Left 968074505 3:195809150-195809172 CCCACCTCTGTCTGCTGTGCCTT 0: 1
1: 0
2: 3
3: 32
4: 389
Right 968074517 3:195809203-195809225 CCTTAAGGAAACCCTCATTGCGG 0: 1
1: 0
2: 1
3: 13
4: 137
968074513_968074517 -3 Left 968074513 3:195809183-195809205 CCTTGAGAGCCAGGGCTGTTCCT 0: 1
1: 0
2: 4
3: 35
4: 347
Right 968074517 3:195809203-195809225 CCTTAAGGAAACCCTCATTGCGG 0: 1
1: 0
2: 1
3: 13
4: 137
968074512_968074517 -2 Left 968074512 3:195809182-195809204 CCCTTGAGAGCCAGGGCTGTTCC 0: 1
1: 0
2: 2
3: 20
4: 194
Right 968074517 3:195809203-195809225 CCTTAAGGAAACCCTCATTGCGG 0: 1
1: 0
2: 1
3: 13
4: 137
968074510_968074517 5 Left 968074510 3:195809175-195809197 CCTTTAACCCTTGAGAGCCAGGG 0: 1
1: 0
2: 3
3: 7
4: 123
Right 968074517 3:195809203-195809225 CCTTAAGGAAACCCTCATTGCGG 0: 1
1: 0
2: 1
3: 13
4: 137
968074508_968074517 11 Left 968074508 3:195809169-195809191 CCTTATCCTTTAACCCTTGAGAG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 968074517 3:195809203-195809225 CCTTAAGGAAACCCTCATTGCGG 0: 1
1: 0
2: 1
3: 13
4: 137
968074507_968074517 26 Left 968074507 3:195809154-195809176 CCTCTGTCTGCTGTGCCTTATCC 0: 1
1: 0
2: 0
3: 20
4: 283
Right 968074517 3:195809203-195809225 CCTTAAGGAAACCCTCATTGCGG 0: 1
1: 0
2: 1
3: 13
4: 137
968074506_968074517 29 Left 968074506 3:195809151-195809173 CCACCTCTGTCTGCTGTGCCTTA 0: 1
1: 0
2: 1
3: 28
4: 331
Right 968074517 3:195809203-195809225 CCTTAAGGAAACCCTCATTGCGG 0: 1
1: 0
2: 1
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968074517 Original CRISPR CCTTAAGGAAACCCTCATTG CGG Intronic
909508017 1:76416942-76416964 TCTTAAGGAATTCCTCACTGAGG + Intronic
916558528 1:165913069-165913091 CTTTAATCAAACCCTAATTGGGG + Intergenic
916683599 1:167125917-167125939 GCTTCAGGAAGCCCTCATTGGGG - Exonic
917701780 1:177589101-177589123 CATTAAGTAAACCATCATTGAGG + Intergenic
920207390 1:204302524-204302546 CCTTGGGGAAAGCCTCCTTGGGG + Intronic
1064398686 10:15002521-15002543 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1068848445 10:61707508-61707530 CATTCAGGAATCCCTTATTGGGG + Intronic
1074338353 10:112601103-112601125 CATTAGGGAAACCTTCATTGTGG + Intronic
1076782456 10:132731724-132731746 ACTGGAGGAAACCCTCACTGGGG - Intronic
1077577301 11:3394200-3394222 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1077603803 11:3593308-3593330 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1083599951 11:63940378-63940400 CCTTAAGGGAACCCTGACTTTGG + Intronic
1084229249 11:67738985-67739007 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1084259698 11:67967897-67967919 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1084813072 11:71627354-71627376 CCTTTAGGAAGCCCTCAGTAAGG - Intergenic
1084846049 11:71900712-71900734 CCTTTAGGAAGCCCTCAGTAAGG - Intronic
1090335323 11:125958704-125958726 CCTTTAGGACAATCTCATTGTGG - Exonic
1090694593 11:129225778-129225800 CCTTAAGGAAACCCAGATGTTGG + Intronic
1091157233 11:133385009-133385031 CCTTGTGGAACCCCTCCTTGTGG + Intronic
1091356091 11:134938679-134938701 CCTTGACGAGACCCTCACTGTGG - Intergenic
1092431006 12:8408868-8408890 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1092433895 12:8431055-8431077 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1095201802 12:39393440-39393462 CCATATGGAAACACTCATTTGGG - Intronic
1096507593 12:52104866-52104888 CCTTTAGGAAGCCCTCAGTAAGG - Intergenic
1102409707 12:112707069-112707091 GCTGAAAGAAACCCTCAGTGTGG - Intronic
1103250216 12:119493342-119493364 CCTGTAGAAAGCCCTCATTGAGG - Intronic
1104859962 12:131918660-131918682 CCCTGAGGAGACCCTCATGGAGG + Exonic
1105006632 12:132725040-132725062 GCTGATGGAAACCCTCATTGGGG - Intergenic
1106163814 13:27224350-27224372 CCTTTAGGACACCCTCCTCGGGG - Intergenic
1107199352 13:37695306-37695328 TCTGAAGGACACCCTCAGTGAGG + Intronic
1107434086 13:40366317-40366339 CTTTGAGGAAACCCTTAATGAGG - Intergenic
1109840054 13:67908525-67908547 CCTTTAGGAAGCCCTCAGTAAGG - Intergenic
1113075508 13:106464251-106464273 TCTTGTGGTAACCCTCATTGTGG + Intergenic
1113716183 13:112509376-112509398 CTTTCAGGAAATCATCATTGAGG - Intronic
1116681180 14:47972361-47972383 CCTGAAGGAAACACTAAATGTGG - Intergenic
1117040690 14:51766464-51766486 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1118775132 14:68969103-68969125 CTTTAAGGAATGCCACATTGGGG - Intronic
1124269908 15:28270826-28270848 ACCTCAGGAAACTCTCATTGGGG + Exonic
1125729637 15:41885925-41885947 CCTTAAGGAAACTCTCCCGGAGG + Exonic
1129257743 15:74343674-74343696 CCTGTAGGAAACCCACACTGTGG - Intronic
1131606055 15:93903812-93903834 ACTTAAGGAAACCCTTCTTCTGG + Intergenic
1133162752 16:3922761-3922783 CCTTAAGGAAAACCTGATATGGG + Intergenic
1146090081 17:29868398-29868420 CCTTGGGGGAACCCTCATGGAGG + Intronic
1146594387 17:34156505-34156527 CCTCAAGGAAAGCCCCAGTGAGG - Intronic
1149120566 17:53158705-53158727 GCTTAGGGAAAGCCTCATTAAGG + Intergenic
1153337075 18:3935952-3935974 CCTTAAGGAAGCCAACATTGGGG - Intronic
1155664432 18:28291107-28291129 CCTTGAGGAAACTCTCATTGAGG + Intergenic
1156202025 18:34844227-34844249 CTTTAAGGAAGCCATTATTGTGG + Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
926685458 2:15694476-15694498 CCTTAAGGAAACCCTAACACAGG + Intronic
927390681 2:22591278-22591300 CCTGAAGGAAACCCTAAATATGG + Intergenic
929511584 2:42569056-42569078 CCTCCACGAAACCCTCATCGGGG + Intronic
932351410 2:71035244-71035266 CCTTCAGGAAGCCCTCAGTTAGG - Intergenic
935126856 2:100231789-100231811 ACTTATGGAATCCCTCATTAAGG - Intergenic
936017264 2:108969029-108969051 CCTCAAGGGATCCCTCATTAAGG + Intronic
936893182 2:117395887-117395909 CCTAAAGGAAACCCTGCATGGGG - Intergenic
937655756 2:124373350-124373372 CTTTAGGGAAATCCTGATTGTGG - Intronic
938979349 2:136510935-136510957 CCTTATGAAAACCCACATTGTGG - Intergenic
939979274 2:148758899-148758921 CATTAATGAAACCCAAATTGAGG + Intronic
940870966 2:158859887-158859909 CCTTTAGGAAGCCCTCAGTAAGG - Intronic
941347278 2:164386117-164386139 CCTAAAGGAAACCAGCATGGTGG - Intergenic
941541767 2:166794685-166794707 CATTAAGGAATCCCTCACTGGGG - Intergenic
1168806114 20:673240-673262 CCCTAAGGAAACCCTGACAGTGG + Intronic
1169694573 20:8372943-8372965 CCTGAAAGAAACCCTCCATGTGG - Intronic
1169878105 20:10319567-10319589 CCTTTATGAAACCCTCACTCAGG + Intergenic
1170719643 20:18865364-18865386 CCTGAAGGAAGCCCTAAATGTGG - Intergenic
1170781829 20:19432191-19432213 CCTCTAGGATACCCGCATTGGGG - Intronic
1170930068 20:20761757-20761779 CCCTAAGGAAGCCCTCATGTGGG - Intergenic
1173544892 20:43888434-43888456 CCTTAATGAAGCCCACATTCTGG - Intergenic
1175581232 20:60101563-60101585 CATTCAGGAAACACTCATTTCGG + Intergenic
1178443613 21:32618645-32618667 CCTTTAGGAAGCCCTCAGTAAGG - Intergenic
1180700495 22:17778925-17778947 CTCTAAAGAAACCCTCATTCGGG - Intergenic
1181772920 22:25139748-25139770 GCTTAGGGAAGCCCTCTTTGAGG + Intronic
1182866623 22:33609986-33610008 CCATAAGTAAACACTCCTTGAGG + Intronic
950126505 3:10513196-10513218 CCTCGAGGAAACCCTCTGTGAGG - Intronic
950166611 3:10805541-10805563 CCTTCAAGAAACCATCATTTTGG + Intergenic
950554477 3:13686833-13686855 CCAGAAGGAAACCCTCAGTTGGG + Intergenic
951676233 3:25245455-25245477 CCTTAAGGAAACACTAAATGTGG - Intronic
952199114 3:31107065-31107087 TCTTAGTGAAACCCTCACTGGGG - Intergenic
955083012 3:55675277-55675299 TCTTACTGCAACCCTCATTGTGG - Intronic
957042985 3:75351202-75351224 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
957045822 3:75373811-75373833 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
957074651 3:75592322-75592344 CCTTCAGGAAGCCCTCAGTAAGG + Intergenic
959295864 3:104532981-104533003 CCTTAAGGAAGCACTAAATGTGG + Intergenic
961276562 3:125731798-125731820 CCTTTAGGAAGCCCTCAGTAAGG - Intergenic
961279450 3:125754389-125754411 CCTTCAGGAAGCCCTCAGTAAGG - Intergenic
962003620 3:131326580-131326602 CATTAAGAAAAGCCTCTTTGAGG - Intronic
962407309 3:135111171-135111193 CCTAAAGGAAACCATCAGTGGGG - Intronic
967098677 3:186197869-186197891 CATTGAGGAAAGCCTCATAGAGG - Intronic
968074517 3:195809203-195809225 CCTTAAGGAAACCCTCATTGCGG + Intronic
968987291 4:3882997-3883019 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
969787039 4:9466550-9466572 CCTTTAGGAAGCCCTCAGTAAGG - Intergenic
969794940 4:9520215-9520237 CCTTTAGGAAGCCCTCAGTAAGG - Intergenic
973038009 4:45431835-45431857 TCTTCAGGAAACCCTCAAAGAGG - Intergenic
973596378 4:52494840-52494862 GCTGAAGGAAGCACTCATTGTGG - Intergenic
978090502 4:104708858-104708880 CCTGAAGGAAACCCTAAATATGG + Intergenic
978095216 4:104768340-104768362 CCTCAAGGAGTCCCACATTGTGG - Intergenic
978116863 4:105029669-105029691 CCTGAAGGAAGCCCTAATTATGG + Intergenic
983071034 4:163267876-163267898 CCTTAAGGAAACAGCAATTGTGG + Intergenic
990428826 5:55714577-55714599 CCTTCAGGAAACCATCAGGGAGG - Intronic
990755608 5:59066188-59066210 CCTTAAGAAAACTCACAGTGTGG + Intronic
991401055 5:66251898-66251920 CCTTCCAGAAACCCTCTTTGGGG + Intergenic
1001158932 5:169297402-169297424 CATTAAGGAAAACCTGAGTGGGG - Intronic
1003366435 6:5479209-5479231 TTTTAGGGAAACCCTCCTTGGGG + Intronic
1005514256 6:26538909-26538931 CCTTCGAGAAACCCTCGTTGAGG + Intronic
1009810417 6:68655783-68655805 TCTTCAGGAAACCATCATTTGGG - Intronic
1011679114 6:89765992-89766014 CCTTAAAGAAAACCTCATTCAGG + Intronic
1011865871 6:91826159-91826181 CCTGAAGGAAACTGACATTGAGG - Intergenic
1012697110 6:102399654-102399676 TCCTAAGGAACCCCTCTTTGAGG + Intergenic
1012721447 6:102751551-102751573 CCTTTAGTGTACCCTCATTGAGG + Intergenic
1020312925 7:6883025-6883047 CCTTTAGGAAACCCTCAGTAAGG + Intergenic
1022320270 7:29281372-29281394 ACTTAAGGAACCCCTTATTTAGG + Intronic
1022711588 7:32855735-32855757 CCCTAAGTAAACTCTCACTGAGG - Intergenic
1022913070 7:34919227-34919249 CCCTAAGTAAACTCTCACTGAGG + Intergenic
1024949586 7:54845769-54845791 ACATAAGGAAACACTCTTTGGGG - Intergenic
1027959426 7:84925789-84925811 CCTTTAGGAAACTCTTATTTAGG - Intergenic
1029012148 7:97273271-97273293 CCTAAAGGAAAACCTGATAGAGG - Intergenic
1029076739 7:97940666-97940688 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1029139843 7:98401520-98401542 CTTGAAGGAAGCCCTCATGGAGG - Intergenic
1031726152 7:125242042-125242064 CCTTATGAAAACCATCACTGTGG + Intergenic
1031953615 7:127918507-127918529 AAATAAGGAAACCCACATTGTGG - Intronic
1036241036 8:7081276-7081298 CCTTTAGGAAGCCCTCAGTAAGG - Intergenic
1036261025 8:7240305-7240327 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1036305584 8:7599242-7599264 CCTTTAGGAAGCCCTCAGTAAGG - Intergenic
1036313062 8:7698849-7698871 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1036356435 8:8047239-8047261 CCTTTAGGAAGCCCTCAGTAAGG - Intergenic
1036818860 8:11923215-11923237 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1036831917 8:12027264-12027286 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1036904838 8:12699516-12699538 CCTTCAGGAAACCCTCAGTAAGG + Intergenic
1039236697 8:35509899-35509921 GCTTAAGGAAACCCTTACTTAGG + Intronic
1039708046 8:40027198-40027220 CCTGAAGAAAACCATCTTTGAGG - Intergenic
1040468589 8:47717474-47717496 GGTTAGGGAAACCCTCCTTGGGG - Intronic
1041223530 8:55675414-55675436 CCTTGAGGAAACACACATGGTGG + Intergenic
1047402335 8:124557524-124557546 CCCTCAGGAAACTCCCATTGGGG - Intronic
1047631450 8:126713180-126713202 CCTTGTGGGAACCCTTATTGTGG - Intergenic
1051899367 9:22022777-22022799 CCTGAAGGAAGCACTAATTGTGG - Intronic
1052021533 9:23531129-23531151 CCTTATAGAAACCATCAGTGAGG + Intergenic
1056072138 9:82998414-82998436 CCAAATGAAAACCCTCATTGTGG - Exonic
1056864017 9:90213533-90213555 CCTTTAGGAAGCCCTCAGTAAGG - Intergenic
1056915880 9:90745887-90745909 CCTTTAGGAAGCCCTCAGTAAGG + Intergenic
1057338389 9:94176646-94176668 CCTTCAGGAAATCTTCATAGAGG + Intergenic
1057954038 9:99393186-99393208 GCATAAGGAAACTCTAATTGGGG - Intergenic
1187261258 X:17687106-17687128 CATTAAAGAAACCATCATAGAGG - Intronic
1189243599 X:39544395-39544417 CCTGAAGGAAGCACTCAATGTGG + Intergenic
1191897293 X:66006498-66006520 TCTCAAAGAAACCTTCATTGAGG + Intergenic
1192620704 X:72677146-72677168 CATTAAGCAAACCCAAATTGAGG - Intronic
1194773138 X:97929448-97929470 CTTTAAGGAAACTCACACTGGGG - Intergenic
1197818617 X:130523973-130523995 CCTTCCGGAGACCCTCATTTGGG + Intergenic
1200691295 Y:6307768-6307790 CCTTAATGATAACTTCATTGTGG - Intergenic
1201018259 Y:9625931-9625953 CCTTAATGATACCTTCATTGTGG - Intergenic
1201043977 Y:9866948-9866970 CCTTAATGATAACTTCATTGTGG + Intergenic
1201588576 Y:15589137-15589159 CCTGAAGGAAGCCCTAAATGTGG - Intergenic