ID: 968075825

View in Genome Browser
Species Human (GRCh38)
Location 3:195815767-195815789
Sequence CTGTGTAAGAAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075825_968075830 3 Left 968075825 3:195815767-195815789 CCGGCCTCCTTCTTCTTACACAG No data
Right 968075830 3:195815793-195815815 CCACATCCTCCTGCCCAGCCCGG No data
968075825_968075837 23 Left 968075825 3:195815767-195815789 CCGGCCTCCTTCTTCTTACACAG No data
Right 968075837 3:195815813-195815835 CGGCCTCCTTCTCCTTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075825 Original CRISPR CTGTGTAAGAAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr