ID: 968075836

View in Genome Browser
Species Human (GRCh38)
Location 3:195815812-195815834
Sequence CTGCGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075836_968075842 3 Left 968075836 3:195815812-195815834 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075842 3:195815838-195815860 CCACATCCTCCTGCCCAGCCCGG No data
968075836_968075849 23 Left 968075836 3:195815812-195815834 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075849 3:195815858-195815880 CGGCCTCCTTCTCCTTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075836 Original CRISPR CTGCGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr