ID: 968075848

View in Genome Browser
Species Human (GRCh38)
Location 3:195815857-195815879
Sequence CTGCGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075848_968075861 23 Left 968075848 3:195815857-195815879 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075861 3:195815903-195815925 CGGCCTCCTTCTCCTTACGCAGG No data
968075848_968075854 3 Left 968075848 3:195815857-195815879 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075854 3:195815883-195815905 CCACATCCTCCTGCCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075848 Original CRISPR CTGCGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr