ID: 968075860

View in Genome Browser
Species Human (GRCh38)
Location 3:195815902-195815924
Sequence CTGCGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075860_968075866 3 Left 968075860 3:195815902-195815924 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075866 3:195815928-195815950 CCACATCCTCCTGCCCAGCCCGG No data
968075860_968075873 23 Left 968075860 3:195815902-195815924 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075873 3:195815948-195815970 CGGCCTCCTTCTCCTTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075860 Original CRISPR CTGCGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr