ID: 968075872

View in Genome Browser
Species Human (GRCh38)
Location 3:195815947-195815969
Sequence CTGCGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075872_968075885 23 Left 968075872 3:195815947-195815969 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075885 3:195815993-195816015 CGGCCTCCTTCTCCCTACGCAGG No data
968075872_968075878 3 Left 968075872 3:195815947-195815969 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075878 3:195815973-195815995 CCACATCCTCCTGCCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075872 Original CRISPR CTGCGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr