ID: 968075884

View in Genome Browser
Species Human (GRCh38)
Location 3:195815992-195816014
Sequence CTGCGTAGGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075884_968075898 23 Left 968075884 3:195815992-195816014 CCGGCCTCCTTCTCCCTACGCAG No data
Right 968075898 3:195816038-195816060 CGGCCTCCTTCTCCTTACGCAGG No data
968075884_968075891 3 Left 968075884 3:195815992-195816014 CCGGCCTCCTTCTCCCTACGCAG No data
Right 968075891 3:195816018-195816040 CCACATCCTCCTGCCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075884 Original CRISPR CTGCGTAGGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr