ID: 968075897

View in Genome Browser
Species Human (GRCh38)
Location 3:195816037-195816059
Sequence CTGCGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075897_968075903 3 Left 968075897 3:195816037-195816059 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075903 3:195816063-195816085 CCACATCCTCCTGCCCAGCCCGG No data
968075897_968075910 23 Left 968075897 3:195816037-195816059 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075910 3:195816083-195816105 CGGCCTCCTTCTCCTTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075897 Original CRISPR CTGCGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr