ID: 968075909

View in Genome Browser
Species Human (GRCh38)
Location 3:195816082-195816104
Sequence CTGCGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075909_968075915 3 Left 968075909 3:195816082-195816104 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075915 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG No data
968075909_968075922 23 Left 968075909 3:195816082-195816104 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075922 3:195816128-195816150 CGGCCTCCTTCTCCTTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075909 Original CRISPR CTGCGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr