ID: 968075915

View in Genome Browser
Species Human (GRCh38)
Location 3:195816108-195816130
Sequence CCACATCCTCCTGCCCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075906_968075915 9 Left 968075906 3:195816076-195816098 CCCAGCCCGGCCTCCTTCTCCTT No data
Right 968075915 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG No data
968075912_968075915 -4 Left 968075912 3:195816089-195816111 CCTTCTCCTTACGCAGGTGCCAC No data
Right 968075915 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG No data
968075911_968075915 -1 Left 968075911 3:195816086-195816108 CCTCCTTCTCCTTACGCAGGTGC No data
Right 968075915 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG No data
968075908_968075915 4 Left 968075908 3:195816081-195816103 CCCGGCCTCCTTCTCCTTACGCA No data
Right 968075915 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG No data
968075913_968075915 -10 Left 968075913 3:195816095-195816117 CCTTACGCAGGTGCCACATCCTC No data
Right 968075915 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG No data
968075902_968075915 22 Left 968075902 3:195816063-195816085 CCACATCCTCCTGCCCAGCCCGG No data
Right 968075915 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG No data
968075904_968075915 16 Left 968075904 3:195816069-195816091 CCTCCTGCCCAGCCCGGCCTCCT No data
Right 968075915 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG No data
968075909_968075915 3 Left 968075909 3:195816082-195816104 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075915 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG No data
968075907_968075915 8 Left 968075907 3:195816077-195816099 CCAGCCCGGCCTCCTTCTCCTTA No data
Right 968075915 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG No data
968075905_968075915 13 Left 968075905 3:195816072-195816094 CCTGCCCAGCCCGGCCTCCTTCT No data
Right 968075915 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075915 Original CRISPR CCACATCCTCCTGCCCAGCC CGG Intergenic
No off target data available for this crispr