ID: 968075921

View in Genome Browser
Species Human (GRCh38)
Location 3:195816127-195816149
Sequence CTGCGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075921_968075927 3 Left 968075921 3:195816127-195816149 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075927 3:195816153-195816175 CCACATCCTCCTGCCCAGCCCGG No data
968075921_968075934 23 Left 968075921 3:195816127-195816149 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075934 3:195816173-195816195 CGGCCTCCTTCTCCTTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075921 Original CRISPR CTGCGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr