ID: 968075922

View in Genome Browser
Species Human (GRCh38)
Location 3:195816128-195816150
Sequence CGGCCTCCTTCTCCTTACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075913_968075922 10 Left 968075913 3:195816095-195816117 CCTTACGCAGGTGCCACATCCTC No data
Right 968075922 3:195816128-195816150 CGGCCTCCTTCTCCTTACGCAGG No data
968075911_968075922 19 Left 968075911 3:195816086-195816108 CCTCCTTCTCCTTACGCAGGTGC No data
Right 968075922 3:195816128-195816150 CGGCCTCCTTCTCCTTACGCAGG No data
968075912_968075922 16 Left 968075912 3:195816089-195816111 CCTTCTCCTTACGCAGGTGCCAC No data
Right 968075922 3:195816128-195816150 CGGCCTCCTTCTCCTTACGCAGG No data
968075907_968075922 28 Left 968075907 3:195816077-195816099 CCAGCCCGGCCTCCTTCTCCTTA No data
Right 968075922 3:195816128-195816150 CGGCCTCCTTCTCCTTACGCAGG No data
968075914_968075922 -3 Left 968075914 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG No data
Right 968075922 3:195816128-195816150 CGGCCTCCTTCTCCTTACGCAGG No data
968075916_968075922 -9 Left 968075916 3:195816114-195816136 CCTCCTGCCCAGCCCGGCCTCCT No data
Right 968075922 3:195816128-195816150 CGGCCTCCTTCTCCTTACGCAGG No data
968075909_968075922 23 Left 968075909 3:195816082-195816104 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075922 3:195816128-195816150 CGGCCTCCTTCTCCTTACGCAGG No data
968075908_968075922 24 Left 968075908 3:195816081-195816103 CCCGGCCTCCTTCTCCTTACGCA No data
Right 968075922 3:195816128-195816150 CGGCCTCCTTCTCCTTACGCAGG No data
968075906_968075922 29 Left 968075906 3:195816076-195816098 CCCAGCCCGGCCTCCTTCTCCTT No data
Right 968075922 3:195816128-195816150 CGGCCTCCTTCTCCTTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075922 Original CRISPR CGGCCTCCTTCTCCTTACGC AGG Intergenic
No off target data available for this crispr