ID: 968075933

View in Genome Browser
Species Human (GRCh38)
Location 3:195816172-195816194
Sequence CTGCGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075933_968075939 3 Left 968075933 3:195816172-195816194 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075939 3:195816198-195816220 CCACATCCTCCTGCCCAGCCCGG No data
968075933_968075946 23 Left 968075933 3:195816172-195816194 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075946 3:195816218-195816240 CGGCCTCCTTCTCCTTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075933 Original CRISPR CTGCGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr