ID: 968075945

View in Genome Browser
Species Human (GRCh38)
Location 3:195816217-195816239
Sequence CTGCGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075945_968075958 23 Left 968075945 3:195816217-195816239 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075958 3:195816263-195816285 CGGCCTCCTTCTCCTTACACAGG No data
968075945_968075951 3 Left 968075945 3:195816217-195816239 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968075951 3:195816243-195816265 CCACATCCTCCTGCCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075945 Original CRISPR CTGCGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr