ID: 968075957

View in Genome Browser
Species Human (GRCh38)
Location 3:195816262-195816284
Sequence CTGTGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075957_968075963 3 Left 968075957 3:195816262-195816284 CCGGCCTCCTTCTCCTTACACAG No data
Right 968075963 3:195816288-195816310 CCACATCCTCCTGCCCAGCCCGG No data
968075957_968075970 23 Left 968075957 3:195816262-195816284 CCGGCCTCCTTCTCCTTACACAG No data
Right 968075970 3:195816308-195816330 CGGCCTCCTTTTCCTTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075957 Original CRISPR CTGTGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr