ID: 968075969

View in Genome Browser
Species Human (GRCh38)
Location 3:195816307-195816329
Sequence CTGTGTAAGGAAAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075969_968075975 3 Left 968075969 3:195816307-195816329 CCGGCCTCCTTTTCCTTACACAG No data
Right 968075975 3:195816333-195816355 CCACATCCTCCTGCTCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075969 Original CRISPR CTGTGTAAGGAAAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr