ID: 968075975

View in Genome Browser
Species Human (GRCh38)
Location 3:195816333-195816355
Sequence CCACATCCTCCTGCTCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075971_968075975 -1 Left 968075971 3:195816311-195816333 CCTCCTTTTCCTTACACAGGTGC No data
Right 968075975 3:195816333-195816355 CCACATCCTCCTGCTCAGCCCGG No data
968075968_968075975 4 Left 968075968 3:195816306-195816328 CCCGGCCTCCTTTTCCTTACACA No data
Right 968075975 3:195816333-195816355 CCACATCCTCCTGCTCAGCCCGG No data
968075967_968075975 8 Left 968075967 3:195816302-195816324 CCAGCCCGGCCTCCTTTTCCTTA No data
Right 968075975 3:195816333-195816355 CCACATCCTCCTGCTCAGCCCGG No data
968075964_968075975 16 Left 968075964 3:195816294-195816316 CCTCCTGCCCAGCCCGGCCTCCT No data
Right 968075975 3:195816333-195816355 CCACATCCTCCTGCTCAGCCCGG No data
968075973_968075975 -10 Left 968075973 3:195816320-195816342 CCTTACACAGGTGCCACATCCTC No data
Right 968075975 3:195816333-195816355 CCACATCCTCCTGCTCAGCCCGG No data
968075965_968075975 13 Left 968075965 3:195816297-195816319 CCTGCCCAGCCCGGCCTCCTTTT No data
Right 968075975 3:195816333-195816355 CCACATCCTCCTGCTCAGCCCGG No data
968075972_968075975 -4 Left 968075972 3:195816314-195816336 CCTTTTCCTTACACAGGTGCCAC No data
Right 968075975 3:195816333-195816355 CCACATCCTCCTGCTCAGCCCGG No data
968075966_968075975 9 Left 968075966 3:195816301-195816323 CCCAGCCCGGCCTCCTTTTCCTT No data
Right 968075975 3:195816333-195816355 CCACATCCTCCTGCTCAGCCCGG No data
968075969_968075975 3 Left 968075969 3:195816307-195816329 CCGGCCTCCTTTTCCTTACACAG No data
Right 968075975 3:195816333-195816355 CCACATCCTCCTGCTCAGCCCGG No data
968075962_968075975 22 Left 968075962 3:195816288-195816310 CCACATCCTCCTGCCCAGCCCGG No data
Right 968075975 3:195816333-195816355 CCACATCCTCCTGCTCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075975 Original CRISPR CCACATCCTCCTGCTCAGCC CGG Intergenic
No off target data available for this crispr