ID: 968075993

View in Genome Browser
Species Human (GRCh38)
Location 3:195816401-195816423
Sequence CCTGGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968075993_968075999 1 Left 968075993 3:195816401-195816423 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968075999 3:195816425-195816447 GCCACATCCTCCGCCCAGCCTGG No data
968075993_968076007 24 Left 968075993 3:195816401-195816423 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076007 3:195816448-195816470 CCTCCGCCCTTCTCCTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968075993 Original CRISPR CCTGGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr