ID: 968076095

View in Genome Browser
Species Human (GRCh38)
Location 3:195816780-195816802
Sequence CTGCGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076095_968076106 17 Left 968076095 3:195816780-195816802 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968076106 3:195816820-195816842 CCGGCCTCCTTCTCCTTACCAGG No data
968076095_968076100 -2 Left 968076095 3:195816780-195816802 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968076100 3:195816801-195816823 AGGTGCCACATCCTCCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076095 Original CRISPR CTGCGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr