ID: 968076105

View in Genome Browser
Species Human (GRCh38)
Location 3:195816820-195816842
Sequence CCTGGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076105_968076119 21 Left 968076105 3:195816820-195816842 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076119 3:195816864-195816886 CCGGCCTCCTTCTCCTTACCAGG No data
968076105_968076112 2 Left 968076105 3:195816820-195816842 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076112 3:195816845-195816867 CCACATCCTCCTGCCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076105 Original CRISPR CCTGGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr