ID: 968076118

View in Genome Browser
Species Human (GRCh38)
Location 3:195816864-195816886
Sequence CCTGGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076118_968076125 2 Left 968076118 3:195816864-195816886 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076125 3:195816889-195816911 CCACATCCTCCTGCCCAGCCCGG No data
968076118_968076132 22 Left 968076118 3:195816864-195816886 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076132 3:195816909-195816931 CGGCCTCCTTCTCCTTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076118 Original CRISPR CCTGGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr