ID: 968076131

View in Genome Browser
Species Human (GRCh38)
Location 3:195816908-195816930
Sequence CTGCGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076131_968076136 -2 Left 968076131 3:195816908-195816930 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968076136 3:195816929-195816951 AGGTGCCACATCCTCCTGCCCGG No data
968076131_968076138 3 Left 968076131 3:195816908-195816930 CCGGCCTCCTTCTCCTTACGCAG No data
Right 968076138 3:195816934-195816956 CCACATCCTCCTGCCCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076131 Original CRISPR CTGCGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr