ID: 968076144

View in Genome Browser
Species Human (GRCh38)
Location 3:195816953-195816975
Sequence CTGTGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076144_968076148 -2 Left 968076144 3:195816953-195816975 CCGGCCTCCTTCTCCTTACACAG No data
Right 968076148 3:195816974-195816996 AGATGCCACATCCTCCTGCCCGG No data
968076144_968076150 3 Left 968076144 3:195816953-195816975 CCGGCCTCCTTCTCCTTACACAG No data
Right 968076150 3:195816979-195817001 CCACATCCTCCTGCCCGGCCCGG No data
968076144_968076157 22 Left 968076144 3:195816953-195816975 CCGGCCTCCTTCTCCTTACACAG No data
Right 968076157 3:195816998-195817020 CCGGCCTCCTTCTCCTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076144 Original CRISPR CTGTGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr