ID: 968076156

View in Genome Browser
Species Human (GRCh38)
Location 3:195816998-195817020
Sequence CCTGGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076156_968076162 -3 Left 968076156 3:195816998-195817020 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076162 3:195817018-195817040 AGGTGCCACATCCTTCTGCCCGG No data
968076156_968076169 20 Left 968076156 3:195816998-195817020 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076169 3:195817041-195817063 CCCGGCCTCCTTCTCCTTACCGG No data
968076156_968076171 21 Left 968076156 3:195816998-195817020 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076171 3:195817042-195817064 CCGGCCTCCTTCTCCTTACCGGG No data
968076156_968076164 2 Left 968076156 3:195816998-195817020 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076164 3:195817023-195817045 CCACATCCTTCTGCCCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076156 Original CRISPR CCTGGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr