ID: 968076170

View in Genome Browser
Species Human (GRCh38)
Location 3:195817042-195817064
Sequence CCCGGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076170_968076182 16 Left 968076170 3:195817042-195817064 CCGGCCTCCTTCTCCTTACCGGG No data
Right 968076182 3:195817081-195817103 CCGGCCTCCTTCTCCTTACCAGG No data
968076170_968076176 -3 Left 968076170 3:195817042-195817064 CCGGCCTCCTTCTCCTTACCGGG No data
Right 968076176 3:195817062-195817084 GGGTGCCACATCCTCCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076170 Original CRISPR CCCGGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr