ID: 968076181

View in Genome Browser
Species Human (GRCh38)
Location 3:195817081-195817103
Sequence CCTGGTAAGGAGAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076181_968076187 -3 Left 968076181 3:195817081-195817103 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076187 3:195817101-195817123 AGGTGCCACATCCTCCTGCCCGG No data
968076181_968076189 2 Left 968076181 3:195817081-195817103 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076189 3:195817106-195817128 CCACATCCTCCTGCCCGGCCCGG No data
968076181_968076196 22 Left 968076181 3:195817081-195817103 CCGGCCTCCTTCTCCTTACCAGG No data
Right 968076196 3:195817126-195817148 CGGCCTCCTTCTCCTTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076181 Original CRISPR CCTGGTAAGGAGAAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr