ID: 968076185

View in Genome Browser
Species Human (GRCh38)
Location 3:195817094-195817116
Sequence GGAGGATGTGGCACCTGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076185_968076200 29 Left 968076185 3:195817094-195817116 CCTTACCAGGTGCCACATCCTCC No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076185_968076196 9 Left 968076185 3:195817094-195817116 CCTTACCAGGTGCCACATCCTCC No data
Right 968076196 3:195817126-195817148 CGGCCTCCTTCTCCTTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076185 Original CRISPR GGAGGATGTGGCACCTGGTA AGG (reversed) Intergenic
No off target data available for this crispr