ID: 968076186

View in Genome Browser
Species Human (GRCh38)
Location 3:195817099-195817121
Sequence GGGCAGGAGGATGTGGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076186_968076196 4 Left 968076186 3:195817099-195817121 CCAGGTGCCACATCCTCCTGCCC No data
Right 968076196 3:195817126-195817148 CGGCCTCCTTCTCCTTATGCAGG No data
968076186_968076200 24 Left 968076186 3:195817099-195817121 CCAGGTGCCACATCCTCCTGCCC No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076186 Original CRISPR GGGCAGGAGGATGTGGCACC TGG (reversed) Intergenic
No off target data available for this crispr