ID: 968076193

View in Genome Browser
Species Human (GRCh38)
Location 3:195817120-195817142
Sequence TAAGGAGAAGGAGGCCGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968076193_968076200 3 Left 968076193 3:195817120-195817142 CCGGCCCGGCCTCCTTCTCCTTA No data
Right 968076200 3:195817146-195817168 AGGTGCCACATCCTCCTGCCCGG No data
968076193_968076206 22 Left 968076193 3:195817120-195817142 CCGGCCCGGCCTCCTTCTCCTTA No data
Right 968076206 3:195817165-195817187 CCGGCCTCCTTCTCCTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968076193 Original CRISPR TAAGGAGAAGGAGGCCGGGC CGG (reversed) Intergenic
No off target data available for this crispr